View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_60 (Length: 324)
Name: NF21120_low_60
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 10 - 304
Target Start/End: Complemental strand, 44531810 - 44531516
Alignment:
| Q |
10 |
aaaaatatcctcaaccttttctaaactctcatgtagtagcaacctatgcaatgctttaccttctccaacttgcagcaacaatggttgcaattatgtttat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531810 |
aaaaaaatcctcaaccttttctaaactctcatgtagtagcaacctatgcaatgctttaccttctccaacttgcagcaacaatggttgcaattatgtttat |
44531711 |
T |
|
| Q |
110 |
tcatatggtgattattctatgacacaaggtattttaggtagtgaaacattcacttttggtgatgatnnnnnnnnccaagtttcagttaaaaacattggtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44531710 |
tcatatggtgattattctatgacacaaggtattttaggtagtgaaacattcacttttggtgatgataaaaaaaaccaagtttcagttaaaaacattggtt |
44531611 |
T |
|
| Q |
210 |
ttggttgtggtgaagacaatgaaggaaaagggtttgaacaagcttcagggttggttggattaggacgtggacctttatctttggtttctcaatta |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44531610 |
ttggttgtggtgaagacaatgaaggaaaagggtttgaacaagcttcagggttggttggattaggacgtggtcctttatctttggtttctcaatta |
44531516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University