View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_67 (Length: 305)
Name: NF21120_low_67
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_67 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 17 - 294
Target Start/End: Original strand, 42005931 - 42006208
Alignment:
| Q |
17 |
actttcgcgacccaacaactgcttggctaacttctgaaggaaaatggagaatcaccataggctccaagattaacaaaactggcgttgctttggtttacga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42005931 |
actttcgcgacccaacaactgcttggctcacttctgaaggaaaatggagaatcaccataggctccaagattaacaaaactggcgttgctttggtttacga |
42006030 |
T |
|
| Q |
117 |
cacagtggacttcaagacctatgagcgtaaagaggatttgcttgacgctgttcctggcaccggtatgtgggagtgtgtggactttttccctgtttccatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006031 |
cacagtggacttcaagacctatgagcgtaaagaggatttgcttgacgctgttcctggcaccggtatgtgggagtgtgtggactttttccctgtttccatg |
42006130 |
T |
|
| Q |
217 |
aagtctgaaaatggcttggatacttctgttaatggggaggaggttaagcatgtgatgaaggtgagcttggatgatgat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006131 |
aagtctgaaaatggcttggatacttctgttaatggggaggaggttaagcatgtgatgaaggtgagcttggatgatgat |
42006208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University