View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_73 (Length: 288)
Name: NF21120_low_73
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 9 - 270
Target Start/End: Original strand, 11429830 - 11430091
Alignment:
| Q |
9 |
gagaagaaaacacattaatcaaggaaatcacagtcgaaaaacatagccattggtcgcagcagatgccaactcggcatcaacttgttcattgcaaacctgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11429830 |
gagaagaaaacacattaatcaaggaaatcacagtcgaaaaacatagccactggtcgcagcagacgccaactcggcatcaacttgttcattgcaaacctgc |
11429929 |
T |
|
| Q |
109 |
acttccatattgcttgtttgacatccacctatcactgatgtagtggtttctcgtgtgttgactgacgaacagaaacttctacacaataaagcctctttca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11429930 |
acttccatattgcttgtttgacatccacctatcactgatgtagtggtttctcgtgtgttgactgacgaacagaaacttctacacaataaagcctctttca |
11430029 |
T |
|
| Q |
209 |
ggattctgaagctcatgtaatgtaatgatagatgaaaatccccaggcctcctcatttgcatt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11430030 |
ggattctgaagctcatgtaatgtaatgatagatgaaaatccccaggcctcctcatttgcatt |
11430091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University