View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_78 (Length: 282)
Name: NF21120_low_78
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_78 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 10930921 - 10930826
Alignment:
| Q |
19 |
tcttttctctctatgcaattctctcaccacccaaatcacatcattcacactcaattcaattccacaactttgatccaatatcaaatacttggaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
10930921 |
tcttttctctctatgcaattctctcaccccccaaatcacatcattcacactcaattcaattccacaactttgatccaatatcgaacacttggaaaa |
10930826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 189 - 272
Target Start/End: Complemental strand, 10930754 - 10930671
Alignment:
| Q |
189 |
gtccaatctatctccgtttccgataatctcatcctcattgccgccaccactcataatctcaccccagcactctcccatcctttg |
272 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10930754 |
gtccaatctatctccgtctccgataatctcatcctcctcgccgccaccactcataatctcaccccagcactatcccatcctttg |
10930671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University