View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_86 (Length: 259)
Name: NF21120_low_86
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 120 - 233
Target Start/End: Complemental strand, 29758840 - 29758725
Alignment:
| Q |
120 |
ggcaaatgttaataattaatgattgtgttagttttaaaaatcaaacccgaagtctcttacttaaaattctttta--gtgtttaggctcaccaactaagat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
29758840 |
ggcaaatgttaataattaatgattgtgttagttttaaaaatcaaacccgaaatctcttacttaaaattcttttaatgtgtttaggctcactaactaagat |
29758741 |
T |
 |
| Q |
218 |
gcctatgtggaacata |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29758740 |
gcctatgtggaacata |
29758725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 29758960 - 29758903
Alignment:
| Q |
1 |
tattaaatgtggccacatgaaatgccaattgtgtttccactttactcttctgtcagag |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29758960 |
tattaaatgtggccacataaaatgccaactgtgtttccactttactcttctgtcagag |
29758903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University