View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_95 (Length: 241)
Name: NF21120_low_95
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_95 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 68 - 225
Target Start/End: Original strand, 33026358 - 33026514
Alignment:
| Q |
68 |
atatagtactattgtgtagtcagaggaaaattgatttctaacacttttttcacttttccaccttgaagagaaaacacatgaattaaataagtgctcttca |
167 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026358 |
atatagtactattgtgtagtcggaggaaaattgatctc-aacacttttttcacctttccaccttgaagagaaaacacatgaattaaataagtgctcttca |
33026456 |
T |
 |
| Q |
168 |
gaatcttgatgactcttgaatatgtgatgataataagcttcaggaccttatgtttcat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33026457 |
gaatcttgatgactcttgaatatgtgatgataatgagcttcaggaccttatgtttcat |
33026514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 58
Target Start/End: Original strand, 33026286 - 33026327
Alignment:
| Q |
17 |
agaaggcataaaaaatgatatatcgaatcagcttctcaaaga |
58 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33026286 |
agaaggcataaaaaatgctatatcgaatcagcttctcaaaga |
33026327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University