View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21121_high_3 (Length: 325)
Name: NF21121_high_3
Description: NF21121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21121_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 629674 - 629903
Alignment:
| Q |
1 |
tcctgtatccaataattgtcaacaaggtggtgctggtgttgttgctgatagtttggttgttgatgtaatcactgaggatgttggtgaagttgttaaggtt |
100 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629674 |
tcctgtttccaataattttcaacaaggtggtgctggtgttgttgctgatagtttggttgttgatgtaatcactgaggatgttggtgaagttgttaaggtt |
629773 |
T |
 |
| Q |
101 |
gttgatcatgctcctgttttagctcaacttccaaagaatgattttcgtaatgatactagattgcaggattttgtggagaaagatatcagcgatcaaagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629774 |
gttgatcatgctcctgttttagctcaaattccaaagaatgattttcgtaatgatactagattgcaggattttgtggagaaagatatcagcgatcaaagta |
629873 |
T |
 |
| Q |
201 |
attttcttgaactctttttatagtgattgg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
629874 |
attttcttgaactctttttatagtgattgg |
629903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 325
Target Start/End: Original strand, 629980 - 630009
Alignment:
| Q |
296 |
agaagtgcaggaagttttcttactctcgag |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
629980 |
agaagtgcaggaagttttcttactctcgag |
630009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University