View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21121_low_2 (Length: 334)
Name: NF21121_low_2
Description: NF21121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21121_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 189 - 324
Target Start/End: Original strand, 27434763 - 27434898
Alignment:
| Q |
189 |
caattattgccggtcttactccagttcaacccagaagctttaactagtagctatttcggttcaatattgagttcaattttaatttacttgctactaatcc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
27434763 |
caattattgccggtcttactccagttcaacccagaagctttaactagtagctatttcggttcaatattgagttcaattttaatttacttgctattactcc |
27434862 |
T |
 |
| Q |
289 |
acctgttgctttcaaaataaaatgacatacattcat |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27434863 |
acctgttgctttcaaaataaaatgacatacattcat |
27434898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 16 - 125
Target Start/End: Original strand, 27434590 - 27434699
Alignment:
| Q |
16 |
ggaactacatattgatatcgtatcaacaaaatttggttaactttgaacaactttgttttcatttttcaaaatcaaataatctgttgttaatactactata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27434590 |
ggaactacatattgatatcgtatcaacaaaatttggttaactttgaacaactttgttttcatttttcaaaatcaaataatctgttgttaatactactata |
27434689 |
T |
 |
| Q |
116 |
taattagctt |
125 |
Q |
| |
|
|||||||||| |
|
|
| T |
27434690 |
taattagctt |
27434699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University