View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21122_high_4 (Length: 340)
Name: NF21122_high_4
Description: NF21122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21122_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 24 - 322
Target Start/End: Original strand, 40182134 - 40182431
Alignment:
| Q |
24 |
acaaattttatcgccgaattatctctgctggagtacagtatgctttgttatgctccatcacttatagcagcttcttcaattttcctggccaaatatatgc |
123 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182134 |
acaaattttatcgccgaattatctctgttggagtacagtatgctttgttatgctccatcacttatagcagcttcttcaattttcctggccaaatatatgc |
40182233 |
T |
 |
| Q |
124 |
ttttccctgcaatgaaaccatgggtatgctgctaatgacgaagattcatgtgtcccattataattagagaaatgaatcataaattttcctttgcttaaca |
223 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40182234 |
ttttccctgccatgaaaccatgggtatgctgctaatgacgaagattcatgtgtcccactataattagag-aatgaatcataaattttcctttgcttaaca |
40182332 |
T |
 |
| Q |
224 |
tgcttgtttgtgtattttgcaacagaatccaacattgcagcattacactcaataccagccttctgatttgtgtgcttgtgtaaaggatctccaccgtct |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182333 |
tgcttgtttgtgtattttgcaacagaatccgacattgcagcattacactcaataccagccttctgatttgtgtgcttgtgtaaaggatctccaccgtct |
40182431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University