View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21124_low_21 (Length: 201)
Name: NF21124_low_21
Description: NF21124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21124_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 13 - 154
Target Start/End: Complemental strand, 25974615 - 25974474
Alignment:
| Q |
13 |
tcgaagaatatagcatttctcgcttttatgatcttgtgggaagacgatgtattgacaaagttactttaatagcctttcgttcaaattattgcgtcccaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||| |
|
|
| T |
25974615 |
tcgaagaatatagcatttctcgcttttatgatcttgtgggaagacgatgtattgacaaagttactttaatagccttacgttcagattattgtgtcccaaa |
25974516 |
T |
|
| Q |
113 |
atttgtttgaagttgtttttatgaatggtttgacgatggagg |
154 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | |||||| |
|
|
| T |
25974515 |
atttgttcgaagttgtttttatgaatggtttgatggtggagg |
25974474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University