View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21125_high_1 (Length: 595)
Name: NF21125_high_1
Description: NF21125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21125_high_1 |
 |  |
|
| [»] chr4 (125 HSPs) |
 |  |
|
| [»] chr2 (105 HSPs) |
 |  |
|
| [»] chr7 (104 HSPs) |
 |  |
|
| [»] chr5 (88 HSPs) |
 |  |
|
| [»] chr1 (121 HSPs) |
 |  |
|
| [»] chr8 (103 HSPs) |
 |  |
|
| [»] chr6 (81 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
| [»] scaffold1619 (1 HSPs) |
 |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
| [»] scaffold1120 (1 HSPs) |
 |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 108)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 382
Target Start/End: Complemental strand, 34899715 - 34899335
Alignment:
| Q |
1 |
ttattataacatttgcatatgcttgtgtggtacgttacgcataaaaaccaagtggaacatgtcaactgacccactaattgaggttctcctaataactaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34899715 |
ttattataacatttgcatatgcttgtgtggtac-ttacgcataaaaaccaagtggaacatgtcaactgacccactagttgaggttctcctaataactaag |
34899617 |
T |
 |
| Q |
101 |
aacatttttagagacacattttcgatattcaattttctgcattcagctaccaactaattatttgtaagtcttagcagacacttcttcatagannnnnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899616 |
aacatttttagagacacattttcgatattcaattttctgcattcagctaccaactaattatttgtaagtcttagcagacacttcttcatagatttttttt |
34899517 |
T |
 |
| Q |
201 |
gttgaagaagtcaaaaattatattaaacgaaaaagagatcccaataaatacaagttgagtttaagaaggatccaaatagcaccacaagaaacaattagag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899516 |
gttgaagaagtcaaaaattatattaaacgaaaaagagatcccaataaatacaagttgagtttaagaaggatccaaatagcaccacaagaaacaattagag |
34899417 |
T |
 |
| Q |
301 |
aagtgtcaaaacaaaagggnnnnnnnnttcattgatgaattgtatagccctgatttttaaaattgagcaagactcttctgat |
382 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34899416 |
aagtgtcaaaacaaaagggaaaaaaaattcattgatgaattgtatagccctgatttttagaattgagcaagactcttctgat |
34899335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 423 - 595
Target Start/End: Complemental strand, 34899294 - 34899123
Alignment:
| Q |
423 |
tactataataactagttttttacaaggttaaaataaacgtatctgtaaacttatgttgaaattttacaaatgtagagccattttatttttattaaacgat |
522 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34899294 |
tactataataaccagttttttacgaggttaaaataaacgtatctgtaaacttatgttgaaattttataaatgtagaaccattctatttttattaaacgat |
34899195 |
T |
 |
| Q |
523 |
gttcggcaactatgtgannnnnnnnngttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899194 |
gttcggcaactatgtga-ttttttttgttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
34899123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 7464482 - 7464526
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7464482 |
tggtggtcggggtttgaaccccggaccttacatatattatgcatt |
7464526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 25727958 - 25728002
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25727958 |
tggtggtcgggatttgaaccccggaccttgcatatattatgcatt |
25728002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 38130950 - 38130994
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38130950 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
38130994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 48849754 - 48849798
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48849754 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
48849798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 48315017 - 48315059
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcatt |
48315059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 334838 - 334882
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
334838 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
334882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 4601914 - 4601870
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4601914 |
tggtggccggggtttgaaccccggaccttgcatttattatgcatt |
4601870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 10922299 - 10922343
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10922299 |
tggtagtcggggtttgaaccccggatcttgcatatattatgcatt |
10922343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 22722472 - 22722428
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
22722472 |
tggtggtcggggtttgaacctcggaccttgcatattttatgcatt |
22722428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 25340915 - 25340959
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25340915 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
25340959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 25441491 - 25441535
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25441491 |
tggtggccggggtttgaaccccagaccttgcatatattatgcatt |
25441535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39779094 - 39779050
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39779094 |
tggtggttggggtttgaaccccgaaccttgcatatattatgcatt |
39779050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 45334259 - 45334215
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45334259 |
tggtggtcgggatttgaaccccgaaccttgcatatattatgcatt |
45334215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 45432018 - 45431974
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45432018 |
tggtggccagggtttgaaccccggaccttgcatatattatgcatt |
45431974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 551 - 594
Target Start/End: Original strand, 8136623 - 8136666
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8136623 |
tggtggtcggggtttgaaccttggaccttgcatatattatgcat |
8136666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 560 - 595
Target Start/End: Original strand, 16663236 - 16663271
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16663236 |
gggtttgaaccccggaccttgcatatattatgcatt |
16663271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 560 - 595
Target Start/End: Complemental strand, 41817560 - 41817525
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41817560 |
gggtttgaaccccggaccttgcatatattatgcatt |
41817525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 555 - 593
Target Start/End: Complemental strand, 552240 - 552202
Alignment:
| Q |
555 |
ggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
552240 |
ggtcggggtttgaaccctggaccttgcatatattatgca |
552202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 561 - 595
Target Start/End: Original strand, 913601 - 913635
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
913601 |
ggtttgaaccccggaccttgcatatattatgcatt |
913635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 591
Target Start/End: Original strand, 1111834 - 1111872
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1111834 |
gtggtcggggtttgaaccccagaccttgcatatattatg |
1111872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 4332660 - 4332702
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4332660 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
4332702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 35347288 - 35347330
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
35347288 |
gtggtcgaggtttgaaccccagaccttgcatatattatgcatt |
35347330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 561 - 595
Target Start/End: Original strand, 48656900 - 48656934
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcatt |
48656934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 16792972 - 16793009
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16792972 |
cggggtttgaaccctggaccttgcatatattatgcatt |
16793009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 46226015 - 46226060
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
46226015 |
ttggtgttcggggttcgaactccggaccttgcatatattatgcatt |
46226060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 554 - 587
Target Start/End: Original strand, 49082703 - 49082736
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatat |
587 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49082703 |
tggtcggggtttgaaccccggaccttgcatatat |
49082736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 51812576 - 51812617
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
51812576 |
tggtggtcgtggtttgaaccccgtaccttgcatatattatgc |
51812617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 916509 - 916465
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
916509 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
916465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 4825409 - 4825365
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4825409 |
tggtggtcgaggttcgaaccccggacctttcatatattatgcatt |
4825365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 8075855 - 8075811
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
8075855 |
tggtggccggggtttgaacctcagaccttgcatatattatgcatt |
8075811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 8238634 - 8238590
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
8238634 |
tggtggccggagtttgaaccccagaccttgcatatattatgcatt |
8238590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 11358304 - 11358264
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
11358304 |
tggtggccggggtttgaaccccggatcttgcatatattatg |
11358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 22251451 - 22251495
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
22251451 |
tggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 27185547 - 27185507
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
27185547 |
tggtggtcgaggtttgaaccccagaccttgcatatattatg |
27185507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 28244095 - 28244139
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28244095 |
tggtgatcggggttcgaaccccggaccttgcatattttatgcatt |
28244139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 29164744 - 29164788
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
29164744 |
tggtggtcggggtttgaaccccagactttgcatatattatacatt |
29164788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29631256 - 29631212
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
29631256 |
tggtggccggggtttgaatcccgaaccttgcatatattatgcatt |
29631212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 31214704 - 31214660
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
31214704 |
tggtggtcggagtttgaatcccggaccttacatatattatgcatt |
31214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 32843253 - 32843297
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
32843253 |
tggtggccggggtttgaaccccagaccttgcatattttatgcatt |
32843297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 40575612 - 40575644
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40575612 |
tttgaaccccggaccttgcatatattatgcatt |
40575644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 44075147 - 44075191
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44075147 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
44075191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 48022305 - 48022349
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
48022305 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcatt |
48022349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 48796209 - 48796253
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
48796209 |
tggtggccggggtttgaaccccgaaccttgcatatcttatgcatt |
48796253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 51882191 - 51882235
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
51882191 |
tggtggccggggtttgaaccctggatcttgcatatattatgcatt |
51882235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 52119446 - 52119402
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcatt |
52119402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 550 - 589
Target Start/End: Original strand, 17589508 - 17589547
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatatta |
589 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
17589508 |
ttggtggtcggggtttgaactccgcaccttgcatatatta |
17589547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 986946 - 986988
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
986946 |
gtggtcggggtttgaaccctggaccttgcatattttatacatt |
986988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 551 - 593
Target Start/End: Original strand, 6835842 - 6835884
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
6835842 |
tggtggtcggggttcgaaccctagaccttgcatatattatgca |
6835884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 11508476 - 11508518
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
11508476 |
gtggtcggggttcgaaccccggaccctgcatatatcatgcatt |
11508518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 20612270 - 20612312
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20612270 |
gtggccggggtttgaaccccaaaccttgcatatattatgcatt |
20612312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 21628881 - 21628923
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
21628881 |
gtggtcggagtttgaaccccggacgttggatatattatgcatt |
21628923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 24348455 - 24348413
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
24348455 |
gtggtcggagtttgaacctctgaccttgcatatattatgcatt |
24348413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 34442440 - 34442482
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
34442440 |
gtggccggggtttgaaccccggaccttacatattttatgcatt |
34442482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 552 - 590
Target Start/End: Complemental strand, 38798929 - 38798891
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
38798929 |
ggtggtcgggatttgaacctcggaccttgcatatattat |
38798891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 42372588 - 42372546
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||||||| |
|
|
| T |
42372588 |
gtggtcggagtttgaaccccggaccttggatatatcatgcatt |
42372546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 551 - 593
Target Start/End: Original strand, 45885468 - 45885510
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
45885468 |
tggtggccggggtttgaacctcagaccttgcatatattatgca |
45885510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 46298048 - 46298090
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
46298048 |
gtggtcagggtttgaacctcggacattgcatatattatgcatt |
46298090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 47099028 - 47099070
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
47099028 |
gtggttgggatttgaaccccgaaccttgcatatattatgcatt |
47099070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 551 - 585
Target Start/End: Original strand, 51047160 - 51047194
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatat |
585 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51047160 |
tggtggtcggggtttgaaccccggaccttacatat |
51047194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 591
Target Start/End: Original strand, 2186421 - 2186458
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
2186421 |
tggtcggggtttgaaccccagaccttacatatattatg |
2186458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 7626463 - 7626496
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
7626463 |
gtttgaaccccggaccttgcatattttatgcatt |
7626496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 7738732 - 7738695
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
7738732 |
cggggcttgaaccccggaccttgcatattttatgcatt |
7738695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 14030726 - 14030767
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
14030726 |
tggtggtcggggtttgaactccaaaccttgcatatattatgc |
14030767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 14160276 - 14160313
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14160276 |
cggggttcgaaccccggactttgcatatattatgcatt |
14160313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 21245860 - 21245819
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
21245860 |
tggtcgaggtttgaaccccagaccttacatatattatgcatt |
21245819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Complemental strand, 28266771 - 28266742
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28266771 |
gaaccccggaccttgcatatattatgcatt |
28266742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 28965775 - 28965812
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
28965775 |
cggggtttgaaccccgaaccttacatatattatgcatt |
28965812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Original strand, 30554869 - 30554910
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
30554869 |
tggtcggggtttgaaccctgaaccttgcatatagtatgcatt |
30554910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 35210122 - 35210163
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
35210122 |
tggtggccgaggtttgaaccccggaccttgcatattttatgc |
35210163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 44579699 - 44579662
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
44579699 |
cggggttcgaaccccggaccttgcatattttatgcatt |
44579662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 44582795 - 44582750
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
44582795 |
tggtggccggggttcgaaccccggaccttgcatattattatgcatt |
44582750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 49975807 - 49975840
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
49975807 |
gtttgaaccccagaccttgcatatattatgcatt |
49975840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 52904141 - 52904178
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
52904141 |
cggggtttgaacccccgacattgcatatattatgcatt |
52904178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 977944 - 977976
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcatt |
977976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 2153492 - 2153536
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | |||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2153492 |
tggtggccagggtttaaaccccagaccttgcatatattatgcatt |
2153536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3582852 - 3582808
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
3582852 |
tggtggtcatggtttgaacctcggaccttgcatattttatgcatt |
3582808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3755409 - 3755365
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
3755409 |
tggtggccgaggtttaaaccctggaccttgcatatattatgcatt |
3755365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 5349598 - 5349554
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
5349598 |
tggtggccagggtttgaacctcggaccttgcatatataatgcatt |
5349554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 7300842 - 7300802
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
7300842 |
tggtggtcggggttcgaatcccgaaccttgcatatattatg |
7300802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Complemental strand, 10926527 - 10926495
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
10926527 |
tttgaaccccgaaccttgcatatattatgcatt |
10926495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 13829076 - 13829112
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgcatt |
13829112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 16873856 - 16873812
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
16873856 |
tggtgatcgaggtttgaacccctaaccttgcatatattatgcatt |
16873812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 20296364 - 20296320
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
20296364 |
tggtcgtcggggtttgaacatcggactttgcatatattatgcatt |
20296320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 594
Target Start/End: Original strand, 20906479 - 20906515
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatat-attatgcat |
594 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20906479 |
ggggtttgaaccccggaccttgcatataattatgcat |
20906515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 21160114 - 21160078
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
21160114 |
ggggtttgaacccccgaccttacatatattatgcatt |
21160078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 22799717 - 22799761
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| | ||||||||| |
|
|
| T |
22799717 |
tggtggtcgaggtttgaacctcggaccttgcatgttttatgcatt |
22799761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 23147969 - 23148009
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||| |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
23147969 |
tggtgttcggggttcgaaccccggacctcgcatatattatg |
23148009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24120411 - 24120455
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||| ||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24120411 |
tggtgatcggagtttgaaccgcggatcttgcatatattatgcatt |
24120455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 25730472 - 25730428
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
25730472 |
tggtggccggggttcgaaccccagaccttgtatatattatgcatt |
25730428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 26768471 - 26768427
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||| ||||||||| |
|
|
| T |
26768471 |
tggtggtcggggtttgaagctcagaccttgcatattttatgcatt |
26768427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 27065731 - 27065767
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
27065731 |
ggggtttgaaccctggaccttgcatattttatgcatt |
27065767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 28430556 - 28430600
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| | ||||||||| | |||||||||||||||||||||| |
|
|
| T |
28430556 |
tggtggtcagagtttgaacctcagaccttgcatatattatgcatt |
28430600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32629150 - 32629106
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32629150 |
tggtggtcgatgttcgaaccccggaccttgcatattttatgcatt |
32629106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 32909292 - 32909336
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
32909292 |
tggtggccgggatttgaacccaggaccttgcatattttatgcatt |
32909336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 33745161 - 33745125
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
33745161 |
ggggtttgaaccccagaccttgcatattttatgcatt |
33745125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 35191816 - 35191852
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35191816 |
ggggttcgaaccccagaccttgcatatattatgcatt |
35191852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 35863804 - 35863844
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
35863804 |
tggtggccgaggtttgaaccccagaccttgcatatattatg |
35863844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 38603028 - 38602984
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
38603028 |
tggtggccggggtttgaaccatgaaccttgcatatattatgcatt |
38602984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 40520822 - 40520778
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
40520822 |
tggtggtcggggtttgaactttggaccttgcatattttatgcatt |
40520778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 46093186 - 46093142
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
46093186 |
tggtggtcggggtttaaaccacaaaccttgcatatattatgcatt |
46093142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 47039497 - 47039453
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| || |||||||| || |||||||||||||||||| |
|
|
| T |
47039497 |
tggtggtcgggattcgaaccccgaactttgcatatattatgcatt |
47039453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 52456551 - 52456507
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
52456551 |
tggtggtcagggttcgaaccccggaccttacatattttatgcatt |
52456507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 52491521 - 52491477
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
52491521 |
tggtcgtcggggttcgaacagcggaccttgcatatattatgcatt |
52491477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 52576017 - 52575973
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||| ||||||||| |
|
|
| T |
52576017 |
tggtggtcgggattcgaaccccagaccttgcatattttatgcatt |
52575973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 53996369 - 53996325
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
53996369 |
tggtggccgggattcgaaccccagaccttgcatatattatgcatt |
53996325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 55066591 - 55066635
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
55066591 |
tggtggccgggatttgaaccccagaccatgcatatattatgcatt |
55066635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 125)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 11949754 - 11949798
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11949754 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
11949798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19479468 - 19479512
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
19479512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 9946497 - 9946453
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9946497 |
tggtggtcggggtttgaaccccggaccttgcatattttatgcatt |
9946453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 21114296 - 21114340
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21114296 |
tggtggtcggggtttgaaccccggaccttgcatatatcatgcatt |
21114340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24664982 - 24665026
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24664982 |
tggtggtcggggttcgaaccccggaccttgcatatattatgcatt |
24665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 49041972 - 49042016
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041972 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
49042016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 14202472 - 14202514
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacatatattatgcatt |
14202514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 551 - 593
Target Start/End: Complemental strand, 17729496 - 17729454
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17729496 |
tggtggtcggggtttgaaccccagaccttgcatatattatgca |
17729454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 549 - 595
Target Start/End: Original strand, 22164258 - 22164304
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
22164258 |
gttggtggtcggggtttgaaccccagaccttacatatattatgcatt |
22164304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 551 - 592
Target Start/End: Complemental strand, 11198398 - 11198357
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11198398 |
tggtggccggggtttgaaccccggaccttgcatatattatgc |
11198357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 44816004 - 44815967
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 54294420 - 54294457
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54294420 |
cggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 675980 - 675944
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcatt |
675944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3936697 - 3936653
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3936697 |
tggtggccggggttcgaaccccggaccttgcatatattatgcatt |
3936653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 7230350 - 7230306
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7230350 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
7230306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8027388 - 8027432
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
8027388 |
tggtggtcggggtttgaacccccgatcttgcatatattatgcatt |
8027432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 19908762 - 19908718
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
19908762 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcatt |
19908718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 20383550 - 20383514
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20383550 |
ggggtttgaaccccggaccttgcatatattatgcatt |
20383514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 21318244 - 21318288
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21318244 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcatt |
21318288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 22630351 - 22630395
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcatt |
22630395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24079831 - 24079875
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
24079831 |
tggtggtcggggtttgaactccggaccttgcatattttatgcatt |
24079875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 34042310 - 34042266
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34042310 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcatt |
34042266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 37930838 - 37930882
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
37930838 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcatt |
37930882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 42845095 - 42845051
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
42845095 |
tggtggtcggagttttaaccccggaccttgcatatattatgcatt |
42845051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 54857606 - 54857650
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54857606 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
54857650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 56551583 - 56551627
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
56551583 |
tggtggccggggtttgaacctcggaccttgcatatattatgcatt |
56551627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 560 - 595
Target Start/End: Original strand, 20799394 - 20799429
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20799394 |
gggtttgaaccccggaccttgcatatattatgcatt |
20799429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 6610331 - 6610289
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6610331 |
gtggtcggggtttgaaccccagaccttgcatatattatacatt |
6610289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 591
Target Start/End: Original strand, 47814244 - 47814282
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatg |
47814282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 17423179 - 17423212
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
17423179 |
gtttgaaccccggaccttgcatatattatgcatt |
17423212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 25783451 - 25783484
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25783451 |
gtttgaaccccggaccttgcatatattatgcatt |
25783484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 37921809 - 37921772
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37921809 |
cggggtttgaatcccggaccttgcatatattatgcatt |
37921772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 554 - 595
Target Start/End: Original strand, 40070962 - 40071003
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40070962 |
tggtcggggtttgaacttcggaccttgcatatattatgcatt |
40071003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 43782295 - 43782340
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
43782295 |
ttggtggtcgaggtttgaaccgcagaccttgcatatattatgcatt |
43782340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 49953405 - 49953438
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49953405 |
gtttgaaccccggaccttgcatatattatgcatt |
49953438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 836226 - 836270
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
836226 |
tggtggtcggagtttgaacctcggaccttgcatatattttgcatt |
836270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 2888944 - 2888900
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2888944 |
tggtggccggggtttgaaccgcggaccttgcatatattatacatt |
2888900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 5924719 - 5924679
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5924719 |
tggtggtcgaggtttgaaccccggaccttccatatattatg |
5924679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 6087809 - 6087773
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6087809 |
ggggtttgaaccccagaccttgcatatattatgcatt |
6087773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 10035335 - 10035295
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
10035335 |
tggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 10261760 - 10261804
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
10261760 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
10261804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 16304089 - 16304133
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcatt |
16304133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 16470374 - 16470330
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
16470374 |
tggtggtcggggttcgaaccctggaccttgcatattttatgcatt |
16470330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 18903749 - 18903793
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
18903749 |
tggtggtcagggtttgaaccccagaccttacatatattatgcatt |
18903793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 19588224 - 19588180
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
19588224 |
tggtggccggggtttgaaccctggaccttgcatattttatgcatt |
19588180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19997355 - 19997399
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
19997355 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcatt |
19997399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 21317329 - 21317373
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
21317329 |
tggtggttgaggtttgaacccctgaccttgcatatattatgcatt |
21317373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 21562695 - 21562651
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
21562695 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
21562651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 23775588 - 23775544
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
23775588 |
tggtggttggggttcgaaccctggaccttgcatatattatgcatt |
23775544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 26926701 - 26926745
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
26926701 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
26926745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 28435247 - 28435283
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28435247 |
ggggtttgaaccccgaaccttgcatatattatgcatt |
28435283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29908126 - 29908082
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29908126 |
tggtgatcgaggtttgaactccggaccttgcatatattatgcatt |
29908082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 555 - 595
Target Start/End: Original strand, 30850379 - 30850419
Alignment:
| Q |
555 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
30850379 |
ggtcggggtttgaaccctgaaccttgcatatattatgcatt |
30850419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 35287498 - 35287542
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35287498 |
tggtggccggggttggaaccccggaccttgcatattttatgcatt |
35287542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 555 - 595
Target Start/End: Complemental strand, 36035900 - 36035860
Alignment:
| Q |
555 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
36035900 |
ggtcggagtttgaaccccggaccttggatatattatgcatt |
36035860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 36490638 - 36490594
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
36490638 |
tggtggtcgggatttgaaccccggatcttgcatacattatgcatt |
36490594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 38375027 - 38374983
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
38375027 |
tggtggccggggtttgaactccagaccttgcatatattatgcatt |
38374983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 43034333 - 43034377
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
43034333 |
tggtggccggggtttgaacctcagaccttgcatatattatgcatt |
43034377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 43330216 - 43330172
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
43330216 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
43330172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 47015559 - 47015603
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
47015559 |
tggtggtcggagtttgaaccccagaccttgtatatattatgcatt |
47015603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 47806247 - 47806291
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
47806247 |
tggtgttcggggttcgaaccccagaccttgcatatattatgcatt |
47806291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 49473707 - 49473671
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49473707 |
ggggttcgaaccccggaccttgcatatattatgcatt |
49473671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 558 - 594
Target Start/End: Original strand, 50152236 - 50152272
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50152236 |
cggggtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 51450282 - 51450238
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
51450282 |
tggtggccggggtttgaactccggaccttgcatatcttatgcatt |
51450238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 555 - 595
Target Start/End: Original strand, 52869004 - 52869044
Alignment:
| Q |
555 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
52869004 |
ggtcggggtttgaactccggaccttgtatatattatgcatt |
52869044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 54500639 - 54500595
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
54500639 |
tggtggtcagtgtttgaaccccggaccttacatatattatgcatt |
54500595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 55061107 - 55061063
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
55061107 |
tggtggtcggaatttgaacccccgaccttgcatatattatgcatt |
55061063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 590
Target Start/End: Complemental strand, 15583632 - 15583593
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
15583632 |
tggtggtcagggtttgaatcccggaccttgcatatattat |
15583593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 594
Target Start/End: Complemental strand, 18094475 - 18094432
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
18094475 |
tggtggttagggtttgaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 590
Target Start/End: Complemental strand, 19840030 - 19839991
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
19840030 |
tggtggtcgtggtttggaccccggaccttgcatatattat |
19839991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Complemental strand, 22040711 - 22040676
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcatt |
22040676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 552 - 595
Target Start/End: Complemental strand, 42139913 - 42139870
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcatt |
42139870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Complemental strand, 43722826 - 43722791
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacatatattatgcatt |
43722791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 281651 - 281617
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
281651 |
ggtttgaaccccggacctttcatatattatgcatt |
281617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 591
Target Start/End: Original strand, 7371537 - 7371579
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
7371537 |
gttggtgtccggggttcgaaccccggaccttgcatatattatg |
7371579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 12322733 - 12322699
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcatt |
12322699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 16737139 - 16737097
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
16737139 |
gtggttgggatttgaacccccgaccttgcatatattatgcatt |
16737097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 550 - 591
Target Start/End: Complemental strand, 24414655 - 24414613
Alignment:
| Q |
550 |
ttggtggtcggggttt-gaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
24414655 |
ttggtggtcggggttttgaaccccagaccttgcatatattatg |
24414613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 595
Target Start/End: Complemental strand, 37800903 - 37800857
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
37800903 |
gttggtgatcggggttcgaaccccagacctcgcatatattatgcatt |
37800857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 43374265 - 43374307
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
43374265 |
gtggtcggggtttgaactccgaaccttgcatattttatgcatt |
43374307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 48226760 - 48226718
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
48226760 |
gtggccggagtttgaaccccggaccttgcatattttatgcatt |
48226718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Original strand, 50362140 - 50362174
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50362140 |
ggtttgaaccctggaccttgcatatattatgcatt |
50362174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 1753350 - 1753387
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1753350 |
cggggtttgaacccccgaccttgcatatgttatgcatt |
1753387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 553 - 594
Target Start/End: Original strand, 2434451 - 2434492
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
2434451 |
gtggtcgaggtttgaacccctgaccttgcatatagtatgcat |
2434492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 14577505 - 14577542
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
14577505 |
cggggtttgaactccggactttgcatatattatgcatt |
14577542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 16431679 - 16431642
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
16431679 |
cggggtttgaaccccagaccttgcatattttatgcatt |
16431642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 18915036 - 18915081
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| || |||||||||||| || |||||||||||||| |
|
|
| T |
18915036 |
ttggtggtcgggattcgaaccccggaccatgaatatattatgcatt |
18915081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 591
Target Start/End: Complemental strand, 19314230 - 19314197
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
19314230 |
cggggtttgagccccggaccttgcatatattatg |
19314197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 23247589 - 23247630
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
23247589 |
tggtggccggggtttaaaccccagaccttgcatatattatgc |
23247630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 23304007 - 23304048
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
23304007 |
tggtggccggggttcgcaccccggaccttgcatatattatgc |
23304048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 592
Target Start/End: Complemental strand, 23810019 - 23809978
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
23810019 |
tggtggccggggtttgaaccctgaaccttgcatatattatgc |
23809978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 25115116 - 25115075
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
25115116 |
tggtcggggtttgaaccctgaaccttgcatatgttatgcatt |
25115075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 29701159 - 29701114
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
29701159 |
ttggtggccggagtttgaaccccggaacttgcatatattatacatt |
29701114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 31138991 - 31139028
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31138991 |
cggggtttgaacctcggaccttgcatattttatgcatt |
31139028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Original strand, 34834012 - 34834041
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34834012 |
gaaccccggaccttgcatatattatgcatt |
34834041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 37193308 - 37193275
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
37193308 |
gtttgaaccccggaccttgcatatattatacatt |
37193275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 41521025 - 41520980
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
41521025 |
ttggtggtcggagtttgaaccttgaaccttgcatatattatgcatt |
41520980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 43155146 - 43155105
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
43155146 |
tggtcggggtttgaacctcagatcttgcatatattatgcatt |
43155105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Original strand, 46676504 - 46676533
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46676504 |
gaaccccggaccttgcatatattatgcatt |
46676533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 49952571 - 49952604
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
49952571 |
gtttgaaccccggaccttacatatattatgcatt |
49952604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 897487 - 897451
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
897487 |
ggggtttgaaccccggaccttacatatattatacatt |
897451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 8607197 - 8607153
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||| ||||||||| |||| |||||||||| |
|
|
| T |
8607197 |
tggtagtcggggtttgaactccggaccttacatacattatgcatt |
8607153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 10336977 - 10337021
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
10336977 |
tggtgttcggggtttgaaccccgaaccttacatacattatgcatt |
10337021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 11085756 - 11085800
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||| | || ||||||||||||||||||||| |
|
|
| T |
11085756 |
tggtggtcggagtttgaatctcgaaccttgcatatattatgcatt |
11085800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 14197422 - 14197466
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| | ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14197422 |
tggtggttgaggtttgaaccccggatcttacatatattatgcatt |
14197466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 14542751 - 14542795
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| || ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
14542751 |
tggtgttcagggttcgaaccccagaccttgcatatattatgcatt |
14542795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15988487 - 15988443
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
15988487 |
tggtggtcgaggttcgaaccccggaccttgtatatagtatgcatt |
15988443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 17948127 - 17948171
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
17948127 |
tggtggtcggggtttgaactccgaaccttacatattttatgcatt |
17948171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 23686290 - 23686334
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
23686290 |
tggtggttggggtttgaaccccgaatcttgcatatattatacatt |
23686334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 560 - 595
Target Start/End: Original strand, 29244284 - 29244320
Alignment:
| Q |
560 |
gggtttgaacc-ccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29244284 |
gggtttgaacctccggaccttgcatatattatgcatt |
29244320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 30135210 - 30135166
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
30135210 |
tggtggtcggggtttgaacctcggatctgacatatattatgcatt |
30135166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 31041707 - 31041751
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
31041707 |
tggtggtcggagttcgaaccccggacattgcatatattatacatt |
31041751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 31692623 - 31692667
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
31692623 |
tggtggtcggggtttgaatccaggatgttgcatatattatgcatt |
31692667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32180900 - 32180856
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||| ||||||||| |
|
|
| T |
32180900 |
tggtggtcggggttcgaaccccagactttgcatattttatgcatt |
32180856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32268151 - 32268107
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
32268151 |
tggtggtcggagtttgaaccccaaacctttcatatattatgcatt |
32268107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 32923202 - 32923238
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
32923202 |
ggggtttgaaccccgaaccttacatatattatgcatt |
32923238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 583
Target Start/End: Complemental strand, 33037067 - 33037035
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcat |
583 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
33037067 |
tggtggtcggggtttgaacctcggaccttgcat |
33037035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 38453327 - 38453291
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
38453327 |
ggggttcgaaccctggaccttgcatatattatgcatt |
38453291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 39595928 - 39595968
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
39595928 |
tggtggtcggagtttgaacctcagaccttgcatatattatg |
39595968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 42344609 - 42344653
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42344609 |
tggtggtcgatgtttgaacctcggaccttgcatatattatacatt |
42344653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 43499661 - 43499617
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |||| |||| |
|
|
| T |
43499661 |
tggtggccggggtttgaaccccggaccttgtatattttatacatt |
43499617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 48171951 - 48171907
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
48171951 |
tggtggtcggggtttgaacctagaaccttgcatatattatacatt |
48171907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 50380827 - 50380871
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| | ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
50380827 |
tggtggtcgagatttgaactccggaccttacatatattatgcatt |
50380871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 53190365 - 53190321
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
53190365 |
tggtgggcgggattcgaaccctggaccttgcatatattatgcatt |
53190321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 56497599 - 56497643
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
56497599 |
tggtggccgggattcgaaccccagaccttgcatatattatgcatt |
56497643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 105)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 31815878 - 31815922
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31815878 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
31815922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 660812 - 660857
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
660812 |
ttggtggtcggggtttgaaccctggaccttgcatatattatgcatt |
660857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 20565066 - 20565110
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20565066 |
tggtggttggggtttgaaccccggaccttgcatatattatgcatt |
20565110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 23250311 - 23250355
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23250311 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcatt |
23250355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 27848228 - 27848184
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27848228 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29544697 - 29544653
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29544697 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
29544653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 31543082 - 31543038
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31543082 |
tggtggttggggtttgaaccccggaccttgcatatattatgcatt |
31543038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 551 - 594
Target Start/End: Original strand, 10735822 - 10735865
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10735822 |
tggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 4180765 - 4180723
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4180765 |
gtggtcggggtttgaaccccggaccttgcatattttatgcatt |
4180723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 8781643 - 8781685
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcatt |
8781685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 42791363 - 42791321
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcatt |
42791321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 29734758 - 29734717
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29734758 |
tggtcggggtttgaaccacggaccttgcatatattatgcatt |
29734717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 553 - 594
Target Start/End: Original strand, 40853811 - 40853852
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcatatattatgcat |
40853852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 5168570 - 5168614
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5168570 |
tggtagtcggggtttgaaccccgaaccttgcatatattatgcatt |
5168614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 9547400 - 9547444
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9547400 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcatt |
9547444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 20200775 - 20200731
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20200775 |
tggtggccggggtttgaaccctggaccttgcatatattatgcatt |
20200731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 23407009 - 23407053
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23407009 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcatt |
23407053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24581008 - 24581052
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
24581008 |
tggtggtcggggtttgaacctcgaaccttgcatatattatgcatt |
24581052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24592837 - 24592881
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24592837 |
tggtggccggggtttgaaccccagaccttgcatatattatgcatt |
24592881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 25186241 - 25186277
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25186241 |
ggggtttgaaccccggaccttgcatatattatgcatt |
25186277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 25612284 - 25612328
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
25612284 |
tggtggtcgggggttgaatcccggaccttgcatatattatgcatt |
25612328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 29896285 - 29896329
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29896285 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcatt |
29896329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 36264470 - 36264514
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
36264470 |
tggtggtcggggtttgaaccccgaactttgcatatattatgcatt |
36264514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 346117 - 346159
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
346117 |
gtggtcggggtttgaaccctggaccttacatatattatgcatt |
346159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 8091151 - 8091193
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8091151 |
gtggtcgatgtttgaaccccggaccttgcatatattatgcatt |
8091193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 18693655 - 18693697
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
18693655 |
gtggtcggggtttgaaccctggatcttgcatatattatgcatt |
18693697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 22709153 - 22709111
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcatt |
22709111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 551 - 593
Target Start/End: Complemental strand, 27411162 - 27411120
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27411162 |
tggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 29600007 - 29599965
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
29600007 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
29599965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 36359374 - 36359340
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36359374 |
ggtttgaaccccggaccttgcatatattatgcatt |
36359340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 43043155 - 43043200
Alignment:
| Q |
551 |
tggtggtcgggg-tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
43043155 |
tggtggtcgggggtttgaaccccggaccttgcatacattatgcatt |
43043200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 44526199 - 44526154
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
44526199 |
ttggtggccggggtttgaatcccggaccttgcgtatattatgcatt |
44526154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 2257041 - 2256997
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
2257041 |
tggtggccggggttcgaaccccagaccttgcatatattatgcatt |
2256997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3708763 - 3708719
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
3708763 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
3708719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 4138061 - 4138017
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
4138061 |
tggtggtcggggtttgaatctcggaccttgcatatattatacatt |
4138017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 4557762 - 4557806
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4557762 |
tggtggtcagggtttgaaccacggaccttacatatattatgcatt |
4557806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 10724009 - 10723965
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
10724009 |
tggtggccggggtttgaacctcagaccttgcatatattatgcatt |
10723965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 11868653 - 11868697
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
11868653 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
11868697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 12599856 - 12599896
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
12599856 |
tggtggtcggggttcgaaccccagaccttgcatatattatg |
12599896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 20455961 - 20455917
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
20455961 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
20455917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 20990895 - 20990939
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
20990895 |
tggtggtcggggtttgaaccctgaaccttgcatattttatgcatt |
20990939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 21482510 - 21482554
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
21482510 |
tggtggtcggggttcaaaccccggaccttgcatatattatacatt |
21482554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 24593446 - 24593402
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24593446 |
tggtgttcagggttcgaaccccggaccttgcatatattatgcatt |
24593402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 25625786 - 25625746
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
25625786 |
tggtggtccgggtttgaaccccggaccttacatatattatg |
25625746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 30089119 - 30089075
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcatt |
30089075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 30125723 - 30125679
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcatt |
30125679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 34977274 - 34977230
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcatt |
34977230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 35360046 - 35360090
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
35360046 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
35360090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 35820292 - 35820336
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35820292 |
tggtggccgaggtttgaaccccggaccttgcatgtattatgcatt |
35820336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 41859922 - 41859878
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcatt |
41859878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 591
Target Start/End: Complemental strand, 44810767 - 44810735
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44810767 |
ggggtttgaaccccggaccttgcatatattatg |
44810735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 594
Target Start/End: Complemental strand, 8728889 - 8728846
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
8728889 |
tggtggtcggggtttgaaccctggatcttgcatattttatgcat |
8728846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 594
Target Start/End: Original strand, 15447705 - 15447748
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
15447705 |
tggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 594
Target Start/End: Complemental strand, 16390673 - 16390630
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
16390673 |
tggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 590
Target Start/End: Complemental strand, 18290722 - 18290683
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
18290722 |
tggtggtcggagtttgaaccccgaaccttgcatatattat |
18290683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 556 - 591
Target Start/End: Original strand, 26387544 - 26387579
Alignment:
| Q |
556 |
gtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26387544 |
gtcggggtttgaactccggaccttgcatatattatg |
26387579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 556 - 595
Target Start/End: Complemental strand, 32458367 - 32458328
Alignment:
| Q |
556 |
gtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
32458367 |
gtcggagtttgaaccctggaccttgcatatattatgcatt |
32458328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 594
Target Start/End: Complemental strand, 37852080 - 37852037
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
37852080 |
tggtggttagggtttgaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 558 - 592
Target Start/End: Original strand, 4927447 - 4927481
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
4927447 |
cggggtttgaaccccggaccttacatatattatgc |
4927481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 12124605 - 12124571
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
12124605 |
ggttcgaaccccggaccttgcatatattatgcatt |
12124571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 13100257 - 13100299
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13100257 |
gtggtcggagtttgaacctcggaccttggatatattatgcatt |
13100299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 30978422 - 30978388
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
30978422 |
ggtttgaacccctgaccttgcatatattatgcatt |
30978388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 551 - 589
Target Start/End: Original strand, 35456811 - 35456849
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
589 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35456811 |
tggtggttggggtttgaaccccgaaccttgcatatatta |
35456849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 41356220 - 41356178
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
41356220 |
gtggtcggggtttgaaccccgaaccttgtatattttatgcatt |
41356178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Original strand, 3113721 - 3113762
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
3113721 |
tggtcgggatttgaatcccggaccttgcatattttatgcatt |
3113762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 7206188 - 7206151
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7206188 |
cggggtttaaacctcggaccttgcatatattatgcatt |
7206151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 559 - 592
Target Start/End: Complemental strand, 10811130 - 10811097
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
10811130 |
ggggtttgaaccccggaccttgcatattttatgc |
10811097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 11560561 - 11560524
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
11560561 |
cggggtttgaaccctgaaccttgcatatattatgcatt |
11560524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 12413556 - 12413519
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
12413556 |
cggggtttgaacctcagaccttgcatatattatgcatt |
12413519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 12425616 - 12425579
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
12425616 |
cggggtttgaacctcagaccttgcatatattatgcatt |
12425579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 19976224 - 19976179
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcatt |
595 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
19976224 |
tggtggtcgaggttcgaaccccggaccttgcatattattatgcatt |
19976179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 20120719 - 20120756
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
20120719 |
cgggatttgaaccccgaaccttgcatatattatgcatt |
20120756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 21870886 - 21870931
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
21870886 |
tggtggtcggggttcgaaccccgaaccttgcatattattatgcatt |
21870931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 24579670 - 24579703
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
24579670 |
gtttgaaccctggaccttgcatatattatgcatt |
24579703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 27244724 - 27244683
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
27244724 |
tggtcgggctttgaaccctagaccttgcatatattatgcatt |
27244683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 584
Target Start/End: Original strand, 34469863 - 34469896
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcata |
584 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
34469863 |
tggtggtcggggttcgaaccccggaccttgcata |
34469896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Original strand, 35281205 - 35281246
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
35281205 |
tggtcggggtttgaacctcgaaccttgcatatattatacatt |
35281246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 41748746 - 41748791
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||| ||||||||| |
|
|
| T |
41748746 |
ttggtggtcggggtttgaatcccggatcttacatattttatgcatt |
41748791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 41763876 - 41763913
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
41763876 |
cggggtttgaaccccggaccgtgcatatactatgcatt |
41763913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 41853436 - 41853391
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
41853436 |
ttggtggccggggttcgaacgccggaccttacatatattatgcatt |
41853391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 44694751 - 44694714
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44694751 |
cggggtttgaaccccgagccttgcatatattatgcatt |
44694714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 3197071 - 3197114
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
3197071 |
tggtggtcggggtttgaatcc-gaaccttgcatatattatgcatt |
3197114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 4238829 - 4238785
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
4238829 |
tggtggtcggagttcgaaccccgaaccttacatatattatgcatt |
4238785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 6765680 - 6765636
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
6765680 |
tggtggtcgtggttcgaaccccggaccttacatattttatgcatt |
6765636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 7537179 - 7537136
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
7537179 |
tggtggttggggtt-gaactccggaccttgcatatattatgcatt |
7537136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 11175855 - 11175811
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
11175855 |
tggtggccggagtttgaaccccagatcttgcatatattatgcatt |
11175811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 13143178 - 13143134
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
13143178 |
tggtggtcagggttcaaacccccgaccttgcatatattatgcatt |
13143134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 17142900 - 17142856
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||||| |||| |
|
|
| T |
17142900 |
tggtggtcggggtttgaactccagactttgcatatattatacatt |
17142856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 555 - 595
Target Start/End: Complemental strand, 19160007 - 19159967
Alignment:
| Q |
555 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19160007 |
ggtcggagtttgaactccgaaccttgcatatattatgcatt |
19159967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 19967488 - 19967444
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
19967488 |
tggtggtcgaggtttgaactccgaaccttgcacatattatgcatt |
19967444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 22571868 - 22571900
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
22571868 |
tttgaaccccggacattgcatatattatgcatt |
22571900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 25274820 - 25274864
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
25274820 |
tggtgttcggggttcgaaccccagaccttacatatattatgcatt |
25274864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 25395433 - 25395477
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
25395433 |
tggtggtcgggatttgaaccttgaaccttgcatatattatgcatt |
25395477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 26427868 - 26427828
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
26427868 |
tggtggtcgggatttgagacccggaccttgcatatattatg |
26427828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 26999180 - 26999136
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
26999180 |
tggtggccggagtttgaaccgcagaccttgcatatattatgcatt |
26999136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 27412827 - 27412871
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
27412827 |
tggtggtcggggtttgaacaacagaccttacatatattatgcatt |
27412871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 30243320 - 30243276
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
30243320 |
tggtggccgaggtttgaaccccgaaccttgtatatattatgcatt |
30243276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 31477041 - 31476997
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
31477041 |
tggtggccgggatttgaaccccgaaccttgtatatattatgcatt |
31476997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 33064056 - 33064012
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
33064056 |
tggtggccggagttcgaactccggaccttgcatatattatgcatt |
33064012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 36441158 - 36441202
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
36441158 |
tggtggtcagggttttaaccccggacaatgcatatattatgcatt |
36441202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Complemental strand, 36474820 - 36474788
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
36474820 |
tttgaaccccggaccttgcatattttatgcatt |
36474788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 38904131 - 38904087
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
38904131 |
tggtggttagggtttgaaccctgaaccttgcatatattatgcatt |
38904087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 40994768 - 40994808
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
40994768 |
tggtggtcggtgtttgaaccccgaaccttgcatctattatg |
40994808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 41778935 - 41778979
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
41778935 |
tggtggccgggattcgaacctcggaccttgcatatattatgcatt |
41778979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 43117189 - 43117225
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |
|
|
| T |
43117189 |
ggggtttgaacctcagaccttgcatatattatgcatt |
43117225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 9e-16; HSPs: 104)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 552 - 595
Target Start/End: Complemental strand, 19599214 - 19599171
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
19599171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 27462427 - 27462471
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27462427 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27462471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 27833392 - 27833436
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27833392 |
tggtggtcggggtttgaaccccggaccttacatatattatgcatt |
27833436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 48629056 - 48629100
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcatt |
48629100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 551 - 589
Target Start/End: Complemental strand, 145588 - 145550
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
145588 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 551 - 593
Target Start/End: Complemental strand, 5579763 - 5579721
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5579763 |
tggtggtcggggtttgaaccccagaccttgcatatattatgca |
5579721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 7670502 - 7670460
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7670502 |
gtggtcgaggtttgaaccccggaccttgcatatattatgcatt |
7670460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 18714511 - 18714474
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18714511 |
cggggtttgaaccccggaccttgcatatattatgcatt |
18714474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3671894 - 3671850
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
3671894 |
tggtggtcggggtttgaactccagaccttgcatatattatgcatt |
3671850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 10242550 - 10242506
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10242550 |
tggtgatcggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 18023749 - 18023705
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
18023749 |
tggtggtcggagtttgaaccctggaccttgcatatattatgcatt |
18023705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 18773747 - 18773791
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
18773747 |
tggtggtcggggtttgaaccccggaccttacatattttatgcatt |
18773791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 19416584 - 19416540
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19416584 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
19416540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 20085758 - 20085794
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20085758 |
ggggtttgaaccccggaccttgcatatattatgcatt |
20085794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 26529682 - 26529726
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
26529682 |
tggtggtcggggtttaaaccccgaaccttgcatatattatgcatt |
26529726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 45088945 - 45088902
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45088945 |
tggtggtcggggtttgaacccc-gaccttgcatatattatgcatt |
45088902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 46371051 - 46371007
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
46371051 |
tggtggtcggagtttgaaccccggaccttggatatattatgcatt |
46371007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 560 - 595
Target Start/End: Complemental strand, 10244788 - 10244753
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcatt |
10244753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 19626518 - 19626560
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcatt |
19626560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 549 - 595
Target Start/End: Original strand, 37495907 - 37495953
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37495907 |
gttggtggtcgggatttgaaccttggaccttgcatatattatgcatt |
37495953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 46737853 - 46737811
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcatt |
46737811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 47342427 - 47342469
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
47342427 |
gtggtcggagtttgaactccggaccttgcatatattatgcatt |
47342469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 554 - 595
Target Start/End: Original strand, 23198743 - 23198784
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
23198743 |
tggtcggggtttgaaccccggactttgcatattttatgcatt |
23198784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 29726867 - 29726826
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
29726867 |
tggtcggggtttgaaccccgaaccttgcatatattatacatt |
29726826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 553 - 594
Target Start/End: Complemental strand, 36121720 - 36121679
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36121720 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 39280820 - 39280853
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcatt |
39280853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 561 - 594
Target Start/End: Original strand, 42095944 - 42095977
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42095944 |
ggtttgaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 553 - 594
Target Start/End: Complemental strand, 43139333 - 43139292
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
43139333 |
gtggtcggggtttgaaccccgtaccttgcatattttatgcat |
43139292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 46987149 - 46987112
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46987149 |
cggggttcgaaccccggaccttgcatatattatgcatt |
46987112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3584274 - 3584230
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
3584274 |
tggtggtcggggtttgaatctcgtaccttgcatatattatgcatt |
3584230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 3830130 - 3830094
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3830130 |
ggggtttgaaccctggaccttgcatatattatgcatt |
3830094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 6023379 - 6023335
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
6023379 |
tggtggtcggggtttgaaccccgaaccttgcatattttaagcatt |
6023335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 7388030 - 7388074
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
7388030 |
tggtggtcggggtttgaatcccgaaccttacatatattatgcatt |
7388074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 7994875 - 7994915
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
7994875 |
tggtggtcggggtttgaaccccagaccttacatatattatg |
7994915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 8084497 - 8084453
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8084497 |
tggtggccggggttcgaaccccggaccttgcatattttatgcatt |
8084453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 10026064 - 10026020
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
10026064 |
tggtggtcggggtttgaaccccataccttgcatattttatgcatt |
10026020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 12167477 - 12167433
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
12167477 |
tggtggttggggtttgaatcccggaccttgaatatattatgcatt |
12167433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 14046602 - 14046646
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14046602 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 14356632 - 14356676
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14356632 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 18684199 - 18684156
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
18684199 |
tggtggtcggggtttgaaccc-ggaccttgcatacattatgcatt |
18684156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 20763224 - 20763180
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
20763224 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
20763180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 21105673 - 21105629
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
21105673 |
tggtggtcggggttcgaacctcgaaccttgcatatattatgcatt |
21105629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 21322245 - 21322201
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21322245 |
tggtggccggggtttgaaccctggaccttgcatacattatgcatt |
21322201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 21554925 - 21554969
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
21554925 |
tggtggtcggggtttgaatcctggaccttgcatatattaagcatt |
21554969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 558 - 590
Target Start/End: Complemental strand, 23147353 - 23147321
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23147353 |
cggggtttgaaccccggaccttgcatatattat |
23147321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 26717919 - 26717963
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26717919 |
tggtggtcagagtttgaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 28230849 - 28230805
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
| T |
28230849 |
tggtggtcggtgtttgaaccccggaccttgcatacatcatgcatt |
28230805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 28736624 - 28736668
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
28736624 |
tggtggttggggtttgaacctcggaccttgcatatatcatgcatt |
28736668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29488790 - 29488746
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
29488790 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
29488746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 33232388 - 33232432
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
33232388 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
33232432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 34284530 - 34284574
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
34284530 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
34284574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 41029342 - 41029298
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
41029342 |
tggtggtcgggattcgaaccccggaccttgcatatattatacatt |
41029298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 42829225 - 42829269
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
42829225 |
tggtggccggagtttgaaccccggagcttgcatatattatgcatt |
42829269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 45046206 - 45046246
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
45046206 |
tggtggtcagagtttgaaccccggaccttgcatatattatg |
45046246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 562 - 593
Target Start/End: Original strand, 42753529 - 42753560
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42753529 |
gtttgaaccccggaccttgcatatattatgca |
42753560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Original strand, 43539104 - 43539139
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcatt |
43539139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 595
Target Start/End: Original strand, 8237621 - 8237667
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
8237621 |
gttggtggccggggtttgaacctcggactttgtatatattatgcatt |
8237667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 25602985 - 25602943
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
25602985 |
gtggttggggtttcaaccccgggccttgcatatattatgcatt |
25602943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 29053111 - 29053069
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
29053111 |
gtggtcggagtttgaaccccggaccttggatatattaagcatt |
29053069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 591
Target Start/End: Complemental strand, 29986669 - 29986627
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
29986669 |
gttggtggacggggtttgaaccctggaccttgcgtatattatg |
29986627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 34448603 - 34448645
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacatatattatgcatt |
34448645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 592
Target Start/End: Complemental strand, 2512379 - 2512338
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
2512379 |
tggtggccggggtttgaacctcgtaccttgcatatattatgc |
2512338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Complemental strand, 2618734 - 2618705
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2618734 |
gaaccccggaccttgcatatattatgcatt |
2618705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 5041398 - 5041365
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
5041398 |
gtttgaaccccagaccttgcatatattatgcatt |
5041365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Original strand, 6225720 - 6225761
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
6225720 |
tggtcggggtttgaaccacagaccttgcatttattatgcatt |
6225761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 6781870 - 6781833
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
6781870 |
cggggtttgaaccctggaccttgcatattttatgcatt |
6781833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 7735601 - 7735556
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
7735601 |
ttggtggtcgggctttgaaccctagaccttgcatattttatgcatt |
7735556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8290460 - 8290505
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcatt |
595 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| ||||||||||| |
|
|
| T |
8290460 |
tggtggtcgggattcgaaccccggaccttgcatattattatgcatt |
8290505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Original strand, 37516796 - 37516837
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
37516796 |
tggtcgaggtttgaactccggaccttgcatatgttatgcatt |
37516837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 38374189 - 38374226
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
38374189 |
cggggtttgaaccctggaccttgcatatactatgcatt |
38374226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 560 - 593
Target Start/End: Original strand, 40808159 - 40808192
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
40808159 |
gggtttgaaccccggaccttgcatattttatgca |
40808192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 40867089 - 40867056
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
40867089 |
gtttgaaccccggaccttgcatatactatgcatt |
40867056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 42336141 - 42336096
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| | || |||||||||||||||||| ||||||||||| |
|
|
| T |
42336141 |
ttggtggtcgagattcgaaccccggaccttgcatgtattatgcatt |
42336096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 47155102 - 47155139
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
47155102 |
cggggttcgaaccctggaccttgcatatattatgcatt |
47155139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 566 - 594
Target Start/End: Original strand, 394366 - 394394
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
394366 |
gaaccccggaccttgcatatattatgcat |
394394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 580917 - 580961
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||| ||||||||| |
|
|
| T |
580917 |
tggtggtcggggttcgaacgccggatcttgcatattttatgcatt |
580961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 1079695 - 1079727
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
1079695 |
tttgaaccccggaccttgcatattttatgcatt |
1079727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 4905346 - 4905302
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
4905346 |
tggtggccggggtttgaactccgaaccttgcatattttatgcatt |
4905302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 5458062 - 5458106
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
5458062 |
tggtgttcgaggtttgaatcccagaccttgcatatattatgcatt |
5458106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 9522982 - 9522938
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcatt |
9522938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 14671240 - 14671196
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
14671240 |
tggtgatcgggattcgaaccccggaccttgtatatattatgcatt |
14671196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15135154 - 15135110
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||| |||| |
|
|
| T |
15135154 |
tggtggtcggggtttgatccccagagcttgcatatattatacatt |
15135110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 16577851 - 16577891
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
16577851 |
tggtggccgaggtttgaaccccagaccttgcatatattatg |
16577891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 16587811 - 16587771
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
16587811 |
tggtggccgaggtttgaaccccagaccttgcatatattatg |
16587771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19036093 - 19036137
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
19036093 |
tggtggccggggtttgaactccagaccttgcatattttatgcatt |
19036137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 20718543 - 20718499
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
20718543 |
tggtggccggggtttgaactccagaccttgcatattttatgcatt |
20718499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 30006083 - 30006127
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
30006083 |
tggtggttggggtttgaaccccaaaccttgcatacattatgcatt |
30006127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 31038513 - 31038557
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| | |||||||| |
|
|
| T |
31038513 |
tggtggccggggtttgaaccccagaccttgcatacaatatgcatt |
31038557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 33473512 - 33473556
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
33473512 |
tggtggccagggttggaaccctggaccttgcatatattatgcatt |
33473556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 33610916 - 33610960
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
33610916 |
tggtggccggtgttcgaactccggaccttgcatatattatgcatt |
33610960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 35222986 - 35222950
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35222986 |
ggggtttgaaccccagaccttgcatatatcatgcatt |
35222950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 37230031 - 37230063
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37230031 |
tttgaaccccagaccttgcatatattatgcatt |
37230063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 37624613 - 37624569
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
37624613 |
tggtggccgggattcgaacccccgaccttgcatatattatgcatt |
37624569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 37930114 - 37930070
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| |||| | | ||||||||||||||||| |
|
|
| T |
37930114 |
tggtggtcggggtttgaatcccgaatcctgcatatattatgcatt |
37930070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39801776 - 39801732
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
39801776 |
tggtggttggggttcgtaccccggatcttgcatatattatgcatt |
39801732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 40187627 - 40187671
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
40187627 |
tggtgttcggggtttgaaccgcagaccttacatatattatgcatt |
40187671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 40752830 - 40752870
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
40752830 |
tggtggccggggttcgaaccccggacattgcatatattatg |
40752870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 555 - 595
Target Start/End: Complemental strand, 40875108 - 40875068
Alignment:
| Q |
555 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
40875108 |
ggtcgaggttcgaaccccggacattgcatatattatgcatt |
40875068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 41250038 - 41250082
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
41250038 |
tggtgttcggggcttgaacctcggaccttgcatatattatacatt |
41250082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 42227796 - 42227840
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||| || ||||| ||||||||||||||| |
|
|
| T |
42227796 |
tggtggtcggagtttgaacctcgaaccttacatatattatgcatt |
42227840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 45425523 - 45425479
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
45425523 |
tggtggccgggattcgaaccccgaaccttgcatatattatgcatt |
45425479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 558 - 590
Target Start/End: Original strand, 46418526 - 46418558
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
46418526 |
cggggtttgaaccccggactttgcatatattat |
46418558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 47607901 - 47607941
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
47607901 |
tggtggccggagtttgaaccctggaccttgcatatattatg |
47607941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 48527260 - 48527216
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
48527260 |
tggtggccgggattcgaactccggaccttgcatatattatgcatt |
48527216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 88)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 549 - 595
Target Start/End: Original strand, 32200436 - 32200482
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32200436 |
gttggtggtcggggcttgaaccccggaccttgcatatattatgcatt |
32200482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 13864414 - 13864374
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13864414 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
13864374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 22522792 - 22522836
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22522792 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
22522836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 40715940 - 40715984
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40715940 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
40715984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 553 - 594
Target Start/End: Complemental strand, 24408563 - 24408522
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24408563 |
gtggtcggggtttgaaccccagaccttgcatatattatgcat |
24408522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 5107236 - 5107280
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcatt |
5107280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 6489077 - 6489033
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6489077 |
tggtggccggggtttgaaccccagaccttgcatatattatgcatt |
6489033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 6624846 - 6624802
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6624846 |
tggtggccggggttcgaaccccggaccttgcatatattatgcatt |
6624802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15889481 - 15889437
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15889481 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcatt |
15889437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 16579365 - 16579409
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16579365 |
tggtggtcagggtttgaaccacggaccttgcatatattatgcatt |
16579409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 16701572 - 16701616
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
16701572 |
tggtggtcggggtttgaatcccggaccttgcatatattattcatt |
16701616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 20721120 - 20721080
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20721120 |
tggtagtcggggtttgaaccccggaccttgcatatattatg |
20721080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 27903183 - 27903139
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
27903183 |
tggtggtcggagtttgaaccccgaaccttgcatatattatgcatt |
27903139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 34436921 - 34436877
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34436921 |
tggtgggcggggtttgaaccccggcccttgcatatattatgcatt |
34436877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39980578 - 39980534
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
39980578 |
tggtggtcggggtttgaactccggaccttgcatattttatgcatt |
39980534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 42817103 - 42817147
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
42817103 |
tggtggtcgaggtttgaaccccggaccttgtatatattatgcatt |
42817147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 34191501 - 34191459
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcatattttatgcatt |
34191459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 42473954 - 42473920
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473954 |
ggtttgaaccccggaccttgcatatattatgcatt |
42473920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 1538799 - 1538840
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
1538799 |
tggtggtcggcgtttgaacctcggaccttgcatatattatgc |
1538840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 13409617 - 13409576
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
13409617 |
tggtcggggtttgaactccggaccttgtatatattatgcatt |
13409576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 551 - 592
Target Start/End: Complemental strand, 14474904 - 14474863
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
14474904 |
tggtggccggggtttgaaccctggaccttgcatatattatgc |
14474863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 21139146 - 21139183
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21139146 |
cgggttttgaaccccggaccttgcatatattatgcatt |
21139183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 25979915 - 25979870
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| || |||||||||||||||||||||||| |||||||||| |
|
|
| T |
25979915 |
ttggtggccgaggtttgaaccccggaccttgcatacattatgcatt |
25979870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 26409324 - 26409279
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26409324 |
ttggtgggcggggttcgaaccccggaccttacatatattatgcatt |
26409279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 39914971 - 39914927
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
39914971 |
ttggtggtcggggttcgaaccc-ggaccttgcatatattatgcatt |
39914927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 553 - 590
Target Start/End: Original strand, 40837896 - 40837933
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40837896 |
gtggtcggggtttgaaccccggaccttgcatattttat |
40837933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 3445238 - 3445282
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
3445238 |
tggtggccgggatttgaaccccggaccttgcatacattatgcatt |
3445282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 6424902 - 6424938
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6424902 |
ggggtttgaaccccggaccttgtatatattatgcatt |
6424938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8544980 - 8545024
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
8544980 |
tggtggtcggagttcgaactccggaccttgcatatattatgcatt |
8545024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 10531610 - 10531566
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
10531610 |
tggtagtcggggtttgaaccacggaccgtgcatatattatgcatt |
10531566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 11637563 - 11637607
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcatt |
11637607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 11720963 - 11720920
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11720963 |
tggtggccggggtttgaaccccg-accttgcatatattatgcatt |
11720920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 12670065 - 12670109
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12670065 |
tggtggtcaaggtttgaaccccgaaccttgcatatattatgcatt |
12670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 13796400 - 13796356
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
13796400 |
tggtggtcggagtttgtaccccagaccttgcatatattatgcatt |
13796356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 17090936 - 17090892
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17090936 |
tggtggccggggtttgaaccccggaccttgcattaattatgcatt |
17090892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 18331777 - 18331733
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
18331777 |
tggtggccggggcttgaaccccggaccttgcatattttatgcatt |
18331733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19518591 - 19518635
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
19518591 |
tggtggtcgaggtttgaacccccggccttgcatatattatgcatt |
19518635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 26655534 - 26655490
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26655534 |
tggtggccggggttcgaaccccggaccttacatatattatgcatt |
26655490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 26927119 - 26927075
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26927119 |
tggtggccggggttcgaaccccggaccttacatatattatgcatt |
26927075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29695085 - 29695041
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
29695085 |
tggtggtcggggtttgaaccacgaaccttacatatattatgcatt |
29695041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 31280089 - 31280045
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
31280089 |
tggtggtcgaggtttgaaccccggatattgcatatattatgcatt |
31280045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32234831 - 32234788
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
32234831 |
tggtggtcggggtttgaacccc-gaccttgcatattttatgcatt |
32234788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32339805 - 32339761
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
32339805 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
32339761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 35493964 - 35494008
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
35493964 |
tggtggtcggagtttgaatcccgaaccttgcatatattatgcatt |
35494008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 37021363 - 37021407
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
37021363 |
tggtggtcggggtttgaaccctgaatcttgcatatattatgcatt |
37021407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 37462181 - 37462137
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
37462181 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
37462137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 37932400 - 37932356
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37932400 |
tggtggccagggttcgaaccccggaccttgcatatattatgcatt |
37932356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 552 - 595
Target Start/End: Complemental strand, 16094126 - 16094083
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
16094126 |
ggtggtcggggtttgaaccccagatcttacatatattatgcatt |
16094083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Original strand, 18589867 - 18589902
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18589867 |
gggtttaaaccccggaccttgcatatattatgcatt |
18589902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 556 - 595
Target Start/End: Complemental strand, 38495207 - 38495168
Alignment:
| Q |
556 |
gtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38495207 |
gtcggggtttgaaccccgaaccttgcatattttatgcatt |
38495168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 2839866 - 2839824
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
2839866 |
gtggtcggagtttgaaccccgaaccttggatatattatgcatt |
2839824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 551 - 589
Target Start/End: Complemental strand, 4009937 - 4009899
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
589 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
4009937 |
tggtggccggggtttgaaccccggcccttgcatatatta |
4009899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Original strand, 4763187 - 4763221
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4763187 |
ggtttgaaccccggaccttacatatattatgcatt |
4763221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 595
Target Start/End: Complemental strand, 5015352 - 5015306
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
5015352 |
gttggtggttggggtttgaactccgaaccttgcatatattattcatt |
5015306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 5846092 - 5846055
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5846092 |
cggggtttgaaccccagactttgcatatattatgcatt |
5846055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 560 - 593
Target Start/End: Original strand, 8882399 - 8882432
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
8882399 |
gggtttgaaccccggaccttacatatattatgca |
8882432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 10704333 - 10704366
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
10704333 |
gtttgaaccccggaccttgcatattttatgcatt |
10704366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 16076498 - 16076457
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
16076498 |
tggtcggggattgaaccctgaaccttgcatatattatgcatt |
16076457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 553 - 594
Target Start/End: Original strand, 17465388 - 17465429
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17465388 |
gtggtcgaggttcgaaccccagaccttgcatatattatgcat |
17465429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 20688099 - 20688066
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
20688099 |
gtttgaactccggaccttgcatatattatgcatt |
20688066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 27679561 - 27679524
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27679561 |
cgggatttgaaccccgaaccttgcatatattatgcatt |
27679524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 553 - 594
Target Start/End: Complemental strand, 33412159 - 33412118
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
33412159 |
gtggccggggtttgaatcctggaccttgcatatattatgcat |
33412118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 33928698 - 33928665
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
33928698 |
gtttaaaccccggaccttgcatatattatgcatt |
33928665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 41630110 - 41630147
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
41630110 |
cggggtttgaatcccgaaccttgcatatattatgcatt |
41630147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3052349 - 3052305
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||||||| |||| |
|
|
| T |
3052349 |
tggtggtcgaggtttgaacctcgaaccttgcatatattatacatt |
3052305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 5614827 - 5614791
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
5614827 |
ggggtttgaacccccgaccttacatatattatgcatt |
5614791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 9893670 - 9893706
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
9893670 |
ggggtttgaaccccagaccttgcatattttatgcatt |
9893706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 12611026 - 12611070
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
12611026 |
tggtggtcgaggttcgaaccccagaccttgcatattttatgcatt |
12611070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 17151833 - 17151877
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
17151833 |
tggtggtcggggtttgaatccaagaccttgcatatattatacatt |
17151877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 18391670 - 18391626
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
18391670 |
tggtggtcgaggttcgaacctcggaccttgcatattttatgcatt |
18391626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 18789098 - 18789062
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
18789098 |
ggggtttgaaccccgaaccttgcatattttatgcatt |
18789062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19068431 - 19068474
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19068431 |
tggtgatcggggtttgaacccca-accttgcatatattatgcatt |
19068474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19647499 - 19647543
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||| |||||| |||||||||| |||| |
|
|
| T |
19647499 |
tggtggtcgggatttgaaccccagaccttacatatattatacatt |
19647543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 19759999 - 19759955
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
19759999 |
tggtggttggggtcttaacctcggaccttgcatatattatgcatt |
19759955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 20125095 - 20125052
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
20125095 |
tggtggtcggagtttgaaccc-gaaccttgcatatattatgcatt |
20125052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 22555301 - 22555257
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
22555301 |
tggtggtcggggtttgattcccggaccttgcatattatatgcatt |
22555257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 549 - 593
Target Start/End: Original strand, 25603989 - 25604033
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||| |||| || |||||||| ||||||||||||||||||| |
|
|
| T |
25603989 |
gttggtggccgggattcgaaccccgaaccttgcatatattatgca |
25604033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 26030442 - 26030486
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
26030442 |
tggtggccggggttcgaaccccggaccttgcaagtattatgcatt |
26030486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 26418933 - 26418973
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
26418933 |
tggtggtcgagatttgaaccccagaccttgcatatattatg |
26418973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 27086140 - 27086104
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
27086140 |
ggggtttgaaccctggaccttgcatatattatacatt |
27086104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 31877990 - 31877954
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
31877990 |
ggggtttgaacccctgatcttgcatatattatgcatt |
31877954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 35413026 - 35412983
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
35413026 |
tggtggccggggttcgaaccc-ggaccttgcatatattatgcatt |
35412983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 37054260 - 37054304
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
37054260 |
tggtggtcggagtttgaaccccgaaccttatatatattatgcatt |
37054304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 554 - 594
Target Start/End: Original strand, 37073762 - 37073802
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
37073762 |
tggtcggggttcgaaccccgaaccttacatatattatgcat |
37073802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39963563 - 39963519
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
39963563 |
tggtggtcagagtttgaaccccgaaccttacatatattatgcatt |
39963519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 40959072 - 40959028
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| ||||||| | | ||||||||||||||||||| |
|
|
| T |
40959072 |
tggtggtcggggtctgaaccctgaatcttgcatatattatgcatt |
40959028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 41266456 - 41266416
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
41266456 |
tggtggtcggggtgtgaaccccgaaccttacatatattatg |
41266416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 41650931 - 41650974
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
41650931 |
tggtggtcggtgtttgaactc-ggaccttgcatatattatgcatt |
41650974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 121)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 12268977 - 12269019
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
12269019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 8269359 - 8269399
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8269359 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
8269399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 17139508 - 17139552
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17139508 |
tggtggtcggggtttgaaccccggaccttgaatatattatgcatt |
17139552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 27533313 - 27533269
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27533313 |
tggtggtcggggtttgaaccccgaaccttgcatatattatgcatt |
27533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 552 - 595
Target Start/End: Complemental strand, 12212364 - 12212321
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcatt |
12212321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 2994826 - 2994784
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatatattatacatt |
2994784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 18166670 - 18166628
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18166670 |
gtggtcggggtttgaaccccggactttgcatatattatgcatt |
18166628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 25533036 - 25532999
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25533036 |
cggggtttgaaccccggaccttgcatatattatgcatt |
25532999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 1794666 - 1794622
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1794666 |
tggtggtcgaggtttgaaccccggatcttgcatatattatgcatt |
1794622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3481631 - 3481587
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3481631 |
tggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 8736505 - 8736461
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8736505 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
8736461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 16307719 - 16307675
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
16307719 |
tggtggtcggggtttgatccccagaccttgcatatattatgcatt |
16307675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 32950752 - 32950796
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32950752 |
tggtggtcgaggtttgaactccggaccttgcatatattatgcatt |
32950796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32962633 - 32962589
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
32962633 |
tggtggtcggggtttgaaccctggaccttgcatattttatgcatt |
32962589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 34521181 - 34521225
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34521181 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34521225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 34595942 - 34595898
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34595942 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 41973325 - 41973281
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41973325 |
tggtggccggggttcgaaccccggaccttgcatatattatgcatt |
41973281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 49431984 - 49432028
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49431984 |
tggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 552 - 595
Target Start/End: Complemental strand, 13401666 - 13401623
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
13401623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 551 - 593
Target Start/End: Complemental strand, 5280701 - 5280659
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
5280701 |
tggtggtcggggttcgaaccccagaccttgcatatattatgca |
5280659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 551 - 589
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
589 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19795107 |
tggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 549 - 595
Target Start/End: Complemental strand, 22335430 - 22335384
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
22335430 |
gttggtgttcggggtttgaacctcagaccttgcatatattatgcatt |
22335384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 23203390 - 23203348
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
23203390 |
gtggtcggggtttgaaccccgaaccttgcatattttatgcatt |
23203348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 32561041 - 32560999
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
32561041 |
gtggtcgggatttgaaccccggaccttgcatatattatacatt |
32560999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 41763148 - 41763190
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcatt |
41763190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 41769808 - 41769850
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
41769808 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
41769850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 2596930 - 2596975
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
2596930 |
ttggaggtcggagtttgaaccccggaccttgcatattttatgcatt |
2596975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 5907862 - 5907825
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5907862 |
cggggtttgaaccctggaccttgcatatattatgcatt |
5907825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 6000141 - 6000178
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6000141 |
cggggtttgaacctcggaccttgcatatattatgcatt |
6000178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 11681286 - 11681249
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11681286 |
cggggtttgaaccccagaccttgcatatattatgcatt |
11681249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 37050996 - 37050955
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37050996 |
tggtcggggttcgaaccccggaccttgcatattttatgcatt |
37050955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3431400 - 3431356
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
3431400 |
tggtggtcggggtttgaacctcgtacattgcatatattatgcatt |
3431356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 591
Target Start/End: Original strand, 3937521 - 3937553
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3937521 |
ggggtttgaaccccggaccttgcatatattatg |
3937553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 5869834 - 5869790
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
5869834 |
tggtggtcggggtttgaactccgaatcttgcatatattatgcatt |
5869790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 587
Target Start/End: Original strand, 6423752 - 6423788
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatat |
587 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6423752 |
tggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 10356706 - 10356749
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10356706 |
tggtggtcggg-tttgaaccccagaccttgcatatattatgcatt |
10356749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 13778631 - 13778587
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
13778631 |
tggtggtcgaggtttgaaccccgaaccttgcatattttatgcatt |
13778587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 15668560 - 15668524
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15668560 |
ggggtttgaaccccggaccttgcatattttatgcatt |
15668524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 16033441 - 16033485
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
16033441 |
tggtggccggagtttgaaccccagaccttgcatatattatgcatt |
16033485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 23405349 - 23405393
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
23405349 |
tggtggtcgggattcgaaccctggaccttgcatatattatgcatt |
23405393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 24571616 - 24571656
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24571616 |
tggtggtcggagtttgaaccccagaccttgcatatattatg |
24571656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 26803450 - 26803486
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26803450 |
ggggtttgaaccccggactttgcatatattatgcatt |
26803486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 28832162 - 28832206
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
28832162 |
tggtggtcgggatttgaacctcagaccttgcatatattatgcatt |
28832206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29042607 - 29042563
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29042607 |
tggtggtcgggatttgaaccccggatcttacatatattatgcatt |
29042563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32944806 - 32944762
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
32944806 |
tggtggtcggggttcgaaccccagacgttgcatatattatgcatt |
32944762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 33153871 - 33153915
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
33153871 |
tggtgttcggggtttgaacctcggaccttacatatattatgcatt |
33153915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 39252137 - 39252177
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
39252137 |
tggtggttggagtttgaaccccggaccttgcatatattatg |
39252177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 40613093 - 40613049
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
40613093 |
tggtggtcgagattcgaaccccggaccttgcatatattatgcatt |
40613049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 42045363 - 42045407
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
42045363 |
tggtggccggggtttgaactccagaccttgcatatattatgcatt |
42045407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 46392303 - 46392259
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
46392303 |
tggtggtcggaatttgaaccccggaccttggatatattatgcatt |
46392259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 594
Target Start/End: Complemental strand, 8094111 - 8094068
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
8094111 |
tggtggccggggtttaaaccccgcaccttgcatatattatgcat |
8094068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Original strand, 10654447 - 10654482
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10654447 |
gggtttgaaccacggaccttgcatatattatgcatt |
10654482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 1605456 - 1605422
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1605456 |
ggtttgaaccccggaccttgcatattttatgcatt |
1605422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 565 - 595
Target Start/End: Original strand, 4968620 - 4968650
Alignment:
| Q |
565 |
tgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4968620 |
tgaaccccggaccttgcatatattatgcatt |
4968650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 22346744 - 22346702
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
22346744 |
gtggtcaggatttgaaccccggaccttgcatattttatgcatt |
22346702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 26755676 - 26755642
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26755676 |
ggtttgaaccccggaccttgcatatataatgcatt |
26755642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Complemental strand, 29739397 - 29739363
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29739397 |
ggtttgaaccccggaccttgcatattttatgcatt |
29739363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 33206799 - 33206841
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
33206799 |
gtggtcggagtttgaaccccagaccttggatatattatgcatt |
33206841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 2209284 - 2209239
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatat-tatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
2209284 |
tggtggtcggggtttgaagcccggacctagcatatatatatgcatt |
2209239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 11462912 - 11462957
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
11462912 |
ttggtggatggggttcgaaccccggaccttgcatattttatgcatt |
11462957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 591
Target Start/End: Complemental strand, 12214063 - 12214023
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
12214063 |
ttggtggtcggggtt-gaaccccagaccttgcatatattatg |
12214023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 12522110 - 12522151
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
12522110 |
tggtggtcggggtttgaacctcagaccttgtatatattatgc |
12522151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 21638176 - 21638139
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
21638176 |
cggggttcgaaccccggaccttgcatatatcatgcatt |
21638139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 28006809 - 28006768
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
28006809 |
tggtcggggtttaaactccggactttgcatatattatgcatt |
28006768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 591
Target Start/End: Complemental strand, 29506894 - 29506857
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
29506894 |
tggtcggggttcgaaccctggaccttgcatatattatg |
29506857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 29800600 - 29800559
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
29800600 |
tggttggggtttgaacccccgaccttgcatattttatgcatt |
29800559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 36679649 - 36679616
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
36679649 |
gtttgaaccccggaccttgcatatattatccatt |
36679616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Original strand, 38448872 - 38448901
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38448872 |
gaaccccggaccttgcatatattatgcatt |
38448901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 45003459 - 45003426
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
45003459 |
gtttgaaccccggaccttgcatatattatccatt |
45003426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Complemental strand, 45481548 - 45481519
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45481548 |
gaaccccggaccttgcatatattatgcatt |
45481519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 46707931 - 46707898
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
46707931 |
gtttgaaccccggaacttgcatatattatgcatt |
46707898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 48646716 - 48646761
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48646716 |
tggtggccggagtttgaaccccggaccttgcatattattatgcatt |
48646761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 49222875 - 49222842
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
49222875 |
gtttgaaccccggaccttgcatatattgtgcatt |
49222842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 64669 - 64713
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
64669 |
tggtggacgaggtttgaactccggactttgcatatattatgcatt |
64713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 127144 - 127100
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||| ||||||| |
|
|
| T |
127144 |
tggtggccgggatttaaaccccggaccttgcatatataatgcatt |
127100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 1091249 - 1091205
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| | |||||||||||| |||||||||| |||||||||| |
|
|
| T |
1091249 |
tggtggtcagagtttgaaccccgaaccttgcatacattatgcatt |
1091205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 5279361 - 5279405
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||| || ||| |||||||||||||||||| |
|
|
| T |
5279361 |
tggtggtcgaggtttgaactccagacattgcatatattatgcatt |
5279405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8210376 - 8210420
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
8210376 |
tggtggccggggttcgaaccctggaccttgtatatattatgcatt |
8210420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 9929230 - 9929266
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
9929230 |
ggggttttaaccctggaccttgcatatattatgcatt |
9929266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 10293006 - 10292962
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
10293006 |
tggtggtcggggtttaaaccccgtcccttacatatattatgcatt |
10292962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 10356174 - 10356218
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
10356174 |
tggtggccggagttcgaaccccggaccgtgcatatattatgcatt |
10356218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 11181926 - 11181970
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| | ||||||| |
|
|
| T |
11181926 |
tggtggccggggtttgaaccccgcaccttgcatatttcatgcatt |
11181970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 16966963 - 16967007
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
16966963 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcatt |
16967007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 16967185 - 16967229
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
16967185 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcatt |
16967229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 17221519 - 17221555
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
17221519 |
ggggttcgaacctcggaccttgcatatattatgcatt |
17221555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 17669715 - 17669671
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
17669715 |
tggtggccggagtttgaaccccgaaccttgcatatattatacatt |
17669671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 17917129 - 17917173
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||| ||||||||| |
|
|
| T |
17917129 |
tggtggtcggggtttgaatcccgaaccttacatattttatgcatt |
17917173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 18043500 - 18043461
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18043500 |
tggtggtcggggtttgaa-cccagaccttgcatatattatg |
18043461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 587
Target Start/End: Complemental strand, 18186747 - 18186711
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatat |
587 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
18186747 |
tggtggttggggtttgaaccccgaaccttgcatatat |
18186711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 591
Target Start/End: Complemental strand, 19620634 - 19620606
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19620634 |
tttgaaccccggaccttgcatatattatg |
19620606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 20415639 - 20415679
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
20415639 |
tggtggtcgaggtttgaatcacggaccttgcatatattatg |
20415679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 26010292 - 26010248
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||| |||| |
|
|
| T |
26010292 |
tggtggtcagggtttgaaccccgaaccttgcatgtattatacatt |
26010248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 28712527 - 28712570
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28712527 |
tggtgatcggggtttgaactccg-accttgcatatattatgcatt |
28712570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 29233965 - 29234009
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
29233965 |
tggtggttggggttcgaaccccagaccttgcatattttatgcatt |
29234009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 29987103 - 29987147
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||| |||| || |||||||||||||||||||||| |
|
|
| T |
29987103 |
tggtggttggggttcgaactccagaccttgcatatattatgcatt |
29987147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Complemental strand, 30521925 - 30521893
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
30521925 |
tttgaatcccggaccttgcatatattatgcatt |
30521893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 31338089 - 31338045
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||| |||| |||||| |||||||||||||| |
|
|
| T |
31338089 |
tggtggtcggagtttgaatcccgcaccttgtatatattatgcatt |
31338045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 32864362 - 32864318
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| | | ||||||||||| |||||||||||||||||| |
|
|
| T |
32864362 |
tggtggtcggagctcgaaccccggactttgcatatattatgcatt |
32864318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 33020042 - 33020078
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |
|
|
| T |
33020042 |
ggggtttgaacctcagaccttgcatatattatgcatt |
33020078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 550 - 590
Target Start/End: Original strand, 33382248 - 33382288
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
33382248 |
ttggtggtcggggtttgaacaccagaccttacatatattat |
33382288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 583
Target Start/End: Original strand, 36260991 - 36261023
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcat |
583 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
36260991 |
tggtggtcggggtttgaatcccggaccttgcat |
36261023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 37045145 - 37045181
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
37045145 |
ggggttcgaaccctggaccttgcatatattatgcatt |
37045181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39949882 - 39949838
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| || ||||||| ||||||| |||||||||||||| |
|
|
| T |
39949882 |
tggtggtcgggattcgaaccccagaccttgtatatattatgcatt |
39949838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 40227899 - 40227855
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||| ||||||||| |
|
|
| T |
40227899 |
tggtggtcggggttcgaaccccagaccttgtatattttatgcatt |
40227855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 40411744 - 40411784
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| |||||| |
|
|
| T |
40411744 |
tggtggtcggggtttgaaccctggaccttacatacattatg |
40411784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 40734996 - 40735040
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
40734996 |
tggtggtcagggtttgaaccccgaaccttacatattttatgcatt |
40735040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 41884796 - 41884836
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||||||| |
|
|
| T |
41884796 |
tggtggccggggttcgaaccccggaccttgtatatattatg |
41884836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 41974831 - 41974787
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
41974831 |
tggtggccggggtttgaacctcaaaccttgcatatattatgcatt |
41974787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 42888637 - 42888601
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
42888637 |
ggggttcgaaccccggaccttgcatattttatgcatt |
42888601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 43356505 - 43356461
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
43356505 |
tggtggtcggggtttgaactccaaaccttacatatattatgcatt |
43356461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 554 - 594
Target Start/End: Complemental strand, 44068989 - 44068949
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
44068989 |
tggtcggtgttcgaactccggaccttgcatatattatgcat |
44068949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 44243943 - 44243899
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
44243943 |
tggtggttggggtttgaactctggaccttacatatattatgcatt |
44243899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Complemental strand, 44641585 - 44641553
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
44641585 |
tttgaaccccgggccttgcatatattatgcatt |
44641553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 44678020 - 44678052
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
44678020 |
tttgaaccccgaaccttgcatatattatgcatt |
44678052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 45139997 - 45140041
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
45139997 |
tggtggccggggtttaaactctggaccttgcatatattatgcatt |
45140041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 48681924 - 48681968
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||| | ||| ||||||||||||||||||||| |
|
|
| T |
48681924 |
tggtggtcggagtttgagctccgaaccttgcatatattatgcatt |
48681968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 50638907 - 50638951
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
50638907 |
tggtggccgggattcgaaccctggaccttgcatatattatgcatt |
50638951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 51067885 - 51067925
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
51067885 |
tggtggtcgggatttgaaccccgagccttgcatatattatg |
51067925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 52043343 - 52043299
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||| ||||||||| |
|
|
| T |
52043343 |
tggtggtcgggatttgaaccccgaacattgcatattttatgcatt |
52043299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 553 - 585
Target Start/End: Complemental strand, 52086177 - 52086145
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatat |
585 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
52086177 |
gtggtcggggtttgaaccccggatcttgcatat |
52086145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 52441502 - 52441546
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
52441502 |
tggtggccggggttcaaacgccggaccttgcatatattatgcatt |
52441546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 103)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 12748971 - 12748927
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12748971 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
12748927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 12800891 - 12800931
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12800891 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
12800931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19163527 - 19163571
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19163527 |
tggtggtcggggtttgaaccccggaccttgcataaattatgcatt |
19163571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 32051523 - 32051567
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32051523 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
32051567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 24023408 - 24023450
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24023408 |
gtggtcggggtttgaaccccggaccttgcatattttatgcatt |
24023450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 551 - 592
Target Start/End: Complemental strand, 7997010 - 7996969
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7997010 |
tggtggtcggggtttgaaccccagaccttgcatatattatgc |
7996969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 23159512 - 23159467
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
23159512 |
ttggtggtcggggtttgaaccccgaatcttgcatatattatgcatt |
23159467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 27718884 - 27718929
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
27718884 |
ttggtggtcggagtttgaactccggaccttgcatatattatgcatt |
27718929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 444483 - 444439
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
444483 |
tggtggccggggtttaaaccccggaccttgcatatattatgcatt |
444439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 8881345 - 8881301
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8881345 |
tggtggccggggtttgaaccctggaccttgcatatattatgcatt |
8881301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8999882 - 8999926
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
8999882 |
tggtggtcggggtttgaaccctggactttgcatatattatgcatt |
8999926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 11709056 - 11709012
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcatt |
11709012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 14598189 - 14598233
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
14598189 |
tggtggtcggggtttgaaccccgcaccttgcttatattatgcatt |
14598233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 18533739 - 18533695
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18533739 |
tggtggttggggtttgaaccccggatcttgcatatattatgcatt |
18533695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 19260570 - 19260614
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19260570 |
tggtggccggggtttgaaccccggaccttacatatattatgcatt |
19260614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24838161 - 24838205
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24838161 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
24838205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 27587291 - 27587247
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27587291 |
tggtggccggggtttgaaccccggaccttgcatatatcatgcatt |
27587247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 558 - 594
Target Start/End: Original strand, 30176417 - 30176453
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30176417 |
cggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 33105453 - 33105417
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33105453 |
ggggtttgaaccccggaccttgcatatattatgcatt |
33105417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 8461829 - 8461871
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
8461829 |
gtggtcggggtttgaactccggaccttgcatattttatgcatt |
8461871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 11053044 - 11053002
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11053044 |
gtggtcggggttcaaaccccggaccttgcatatattatgcatt |
11053002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 13124361 - 13124398
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13124361 |
cggggtttgaaccccggaccttgcatattttatgcatt |
13124398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 26799255 - 26799210
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
26799255 |
ttggtggtcggggttttaaccccgaaccttgcatattttatgcatt |
26799210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 27571839 - 27571884
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
27571839 |
ttggtggtcgggatttgaaccccaaaccttgcatatattatgcatt |
27571884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 3650590 - 3650546
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3650590 |
tggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 6471581 - 6471537
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6471581 |
tggtggccggggtttgaaccccgaacattgcatatattatgcatt |
6471537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8717466 - 8717510
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcatt |
8717510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 15147020 - 15147060
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
15147020 |
tggtggtcgggatttgagccccggaccttgcatatattatg |
15147060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 20665354 - 20665398
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
20665354 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
20665398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 22775698 - 22775654
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22775698 |
tggtggccagggtttgaaccccggaccttgcataaattatgcatt |
22775654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24023699 - 24023743
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| |||| |
|
|
| T |
24023699 |
tggtggtcggggtttgaaccccggaccttgcagacattatacatt |
24023743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 26932754 - 26932798
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
26932754 |
tggtggtcgtggtttgaaccctggaccttgcatatatcatgcatt |
26932798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29376971 - 29376927
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
29376971 |
tggtggtcggggtttgaactccagaccttgcatatattacgcatt |
29376927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29652288 - 29652244
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
29652288 |
tggtggtcgaggtttgaactctggaccttgcatatattatgcatt |
29652244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 30550717 - 30550761
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
30550717 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
30550761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 32944831 - 32944875
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
32944831 |
tggtggtcggggtttgaacctcagaccttgcatattttatgcatt |
32944875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 33996139 - 33996095
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
33996139 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcatt |
33996095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 37141427 - 37141383
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
37141427 |
tggtggccggagtttgaaccccgaaccttgcatatattatgcatt |
37141383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 42172234 - 42172278
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
42172234 |
tggtggttggggtttgaactccggatcttgcatatattatgcatt |
42172278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 44215466 - 44215510
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44215466 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
44215510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 44632176 - 44632220
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
44632176 |
tggtggtcggggtttgaaccccgaaccttatatatattatgcatt |
44632220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 594
Target Start/End: Original strand, 6235542 - 6235585
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
6235542 |
tggtggccggggtttgaatcccggaccttacatatattatgcat |
6235585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 552 - 591
Target Start/End: Complemental strand, 24195318 - 24195279
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
24195318 |
ggtgatcggagtttgaaccccggaccttgcatatattatg |
24195279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 590
Target Start/End: Complemental strand, 29546963 - 29546924
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29546963 |
tggtggtcagggtttgaaccccagaccttgcatatattat |
29546924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 556 - 595
Target Start/End: Original strand, 31336803 - 31336842
Alignment:
| Q |
556 |
gtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31336803 |
gtcggggtttgaaccctagaccttgcatatattatgcatt |
31336842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 556 - 595
Target Start/End: Complemental strand, 32192959 - 32192920
Alignment:
| Q |
556 |
gtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32192959 |
gtcggggttcgaaccccgaaccttgcatatattatgcatt |
32192920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 34645078 - 34645121
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcata-tattatgcatt |
595 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
34645078 |
gtggtcggggttcgaaccccggaccttgcatattattatgcatt |
34645121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 552 - 591
Target Start/End: Complemental strand, 36781477 - 36781438
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
36781477 |
ggtggtcggggtttaaaccccggactttgcatatattatg |
36781438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Complemental strand, 39821945 - 39821910
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcatt |
39821910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 552 - 595
Target Start/End: Complemental strand, 44794962 - 44794919
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44794962 |
ggtggccgaggtttgaactccggaccttgcatatattatgcatt |
44794919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 4830076 - 4830034
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
4830076 |
gtggtcgggattcgaaccccgaaccttgcatatattatgcatt |
4830034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Original strand, 10871895 - 10871929
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
10871895 |
ggtttgaaccccggaccttgcatacattatgcatt |
10871929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 557 - 595
Target Start/End: Complemental strand, 28440023 - 28439985
Alignment:
| Q |
557 |
tcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
28440023 |
tcggggtttgaaccccagaccttacatatattatgcatt |
28439985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 557 - 595
Target Start/End: Complemental strand, 30623357 - 30623319
Alignment:
| Q |
557 |
tcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
30623357 |
tcggggttcgaaccccagaccttgcatatattatgcatt |
30623319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 551 - 593
Target Start/End: Original strand, 32286355 - 32286397
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
32286355 |
tggtggccggggtttgaaccccgaatcttgcatatattatgca |
32286397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 560 - 590
Target Start/End: Complemental strand, 32421630 - 32421600
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32421630 |
gggtttgaaccccggaccttgcatatattat |
32421600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 561 - 595
Target Start/End: Original strand, 42208470 - 42208504
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
42208470 |
ggtttgaacctcggaccttgcatatattatgcatt |
42208504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 7869639 - 7869676
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7869639 |
cggggtttgaacccccaaccttgcatatattatgcatt |
7869676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 18942981 - 18942944
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
18942981 |
cggggtttgaaacccggaccatgcatatattatgcatt |
18942944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Complemental strand, 19778120 - 19778091
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19778120 |
gaaccccggaccttgcatatattatgcatt |
19778091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 24338194 - 24338239
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
24338194 |
ttggtggtcggggtttgaacttcagaccttgcatattttatgcatt |
24338239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 26196594 - 26196639
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
26196594 |
ttggtggccggagtttgaaccacgaaccttgcatatattatgcatt |
26196639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 553 - 590
Target Start/End: Complemental strand, 34438472 - 34438435
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
34438472 |
gtggtcggggtttcaaccccggaccttgcatattttat |
34438435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 591
Target Start/End: Original strand, 36428692 - 36428725
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
36428692 |
cggggtttgaacccctgaccttgcatatattatg |
36428725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 37938562 - 37938521
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
37938562 |
tggtcgggatttgaacctcggactttgcatatattatgcatt |
37938521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Original strand, 44084262 - 44084306
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44084262 |
ttggtggccgaggtttgaaccc-ggaccttgcatatattatgcatt |
44084306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 591
Target Start/End: Complemental strand, 4077751 - 4077719
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
4077751 |
ggggtttgaaccccgaaccttgcatatattatg |
4077719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Complemental strand, 6447247 - 6447215
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
6447247 |
tttgaactccggaccttgcatatattatgcatt |
6447215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 9192218 - 9192262
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
9192218 |
tggtggccggggtttgaaccccagactttacatatattatgcatt |
9192262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 9241085 - 9241041
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9241085 |
tggtggccggggtttgaacatcggaccttacatatattatgcatt |
9241041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 9478026 - 9478070
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||| |||||||||| |
|
|
| T |
9478026 |
tggtggtcagggtttgatccccagaccttgcatacattatgcatt |
9478070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 579
Target Start/End: Original strand, 10171561 - 10171589
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggacctt |
579 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10171561 |
tggtggtcggggtttgaaccccggacctt |
10171589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 587
Target Start/End: Complemental strand, 10752479 - 10752443
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatat |
587 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10752479 |
tggtggtcggggtttgaaccccagaccttgaatatat |
10752443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 11603828 - 11603872
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
11603828 |
tggtggtcgaggtttgaactcccaaccttgcatatattatgcatt |
11603872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 12714373 - 12714405
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
12714373 |
tttgaaccccgaaccttgcatatattatgcatt |
12714405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 13357432 - 13357476
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| || |||||||||| || ||||||||||||||||||||| |
|
|
| T |
13357432 |
tggtggccgaggtttgaacctcgtaccttgcatatattatgcatt |
13357476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 15001266 - 15001310
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
15001266 |
tggtggccggggtttgaaccttggaccttgcatattttatgcatt |
15001310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15020831 - 15020787
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||||||| |||| |
|
|
| T |
15020831 |
tggtggccagggtttgaaccccggatcttgcatatattatacatt |
15020787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 567 - 595
Target Start/End: Complemental strand, 15438507 - 15438479
Alignment:
| Q |
567 |
aaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15438507 |
aaccccggaccttgcatatattatgcatt |
15438479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 567 - 595
Target Start/End: Complemental strand, 15529811 - 15529783
Alignment:
| Q |
567 |
aaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15529811 |
aaccccggaccttgcatatattatgcatt |
15529783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 17898149 - 17898109
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
17898149 |
tggtggccggggttagaatcccggaccttgcatatattatg |
17898109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 18422444 - 18422488
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
18422444 |
tggtggttggggtttgaatcccgaaccttacatatattatgcatt |
18422488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 20275188 - 20275224
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
20275188 |
ggggtttgaaccccgaaccttgcatgtattatgcatt |
20275224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 21061815 - 21061851
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
21061815 |
ggggtttgaaccccgaaccttgcatgtattatgcatt |
21061851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 21557503 - 21557459
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| || ||||| |||||||| ||||||||||||||| |
|
|
| T |
21557503 |
tggtggtcgggattcgaacctcggaccttacatatattatgcatt |
21557459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 567 - 595
Target Start/End: Original strand, 22948088 - 22948116
Alignment:
| Q |
567 |
aaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22948088 |
aaccccggaccttgcatatattatgcatt |
22948116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 25277215 - 25277251
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
25277215 |
ggggttcgaaccccggaccttgcatattttatgcatt |
25277251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 26991748 - 26991792
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
26991748 |
tggtggtcgtggtttgaaccacaaaccttgcatatattatgcatt |
26991792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 27134411 - 27134455
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||||||||||||| |||| |
|
|
| T |
27134411 |
tggttgtcggagtttgaaccccggactttgcatatattatacatt |
27134455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 561 - 593
Target Start/End: Original strand, 27750905 - 27750937
Alignment:
| Q |
561 |
ggtttgaaccccggaccttgcatatattatgca |
593 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
27750905 |
ggttcgaaccccggaccttgcatatattatgca |
27750937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 28581014 - 28580970
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
28581014 |
tggtggtcgggatttgaaccccgaaccttacatattttatgcatt |
28580970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 29716691 - 29716731
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
29716691 |
tggtggccggagtttgaatcccggaccttgcatatattatg |
29716731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 29924916 - 29924952
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29924916 |
ggggtttaaaccccgaaccttgcatatattatgcatt |
29924952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 30218273 - 30218229
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
30218273 |
tggttgtcggggtttaaactccggacattgcatatattatgcatt |
30218229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 30417601 - 30417645
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||| |||| |
|
|
| T |
30417601 |
tggtggacggggtttgaaccccgaaccatgcatatattatacatt |
30417645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 35700386 - 35700430
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
35700386 |
tggtggtcggagtttgaaccccgaattttgcatatattatgcatt |
35700430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 37749990 - 37750034
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
37749990 |
tggtggccggggttcaaaccccggactttgcatatattatgcatt |
37750034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 38763506 - 38763550
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| | ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
38763506 |
tggtggccagggttcgaaccccagaccttgcatatattatgcatt |
38763550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39076590 - 39076546
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39076590 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
39076546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39077076 - 39077032
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39077076 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcatt |
39077032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 39138989 - 39139033
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
39138989 |
tggtggtcggagtttgaaccccgaaccttacatattttatgcatt |
39139033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 40167392 - 40167348
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
40167392 |
tggtggccggggtttgaatcccgaaccttgtatatattatgcatt |
40167348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 43778089 - 43778045
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||| ||||||||| |
|
|
| T |
43778089 |
tggtggtcggagtttgaacctcagaccttgcatattttatgcatt |
43778045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 81)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 8569779 - 8569735
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569779 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
8569735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15187133 - 15187089
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15187133 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcatt |
15187089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 15473473 - 15473517
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15473473 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcatt |
15473517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Complemental strand, 20744206 - 20744164
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcatt |
20744164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 34481407 - 34481449
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34481407 |
gtggtcggggtttgaaccccggaccttgcatatataatgcatt |
34481449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 551 - 592
Target Start/End: Original strand, 4455587 - 4455628
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4455587 |
tggtggtcggggtttgaaccccagaccttgcatatattatgc |
4455628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 13496183 - 13496142
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13496183 |
tggtcggggtttgaactccggaccttgcatatattatgcatt |
13496142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 33824952 - 33824907
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824952 |
ttggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
33824907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 788936 - 788892
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
788936 |
tggtggtcggggtttgaactccgaaccttgcatatattatgcatt |
788892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 2546250 - 2546210
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2546250 |
tggtggtcggggtttgaaccccgtaccttgcatatattatg |
2546210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8629687 - 8629731
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8629687 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcatt |
8629731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 9977127 - 9977083
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9977127 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcatt |
9977083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15155805 - 15155761
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
15155805 |
tggtggtcgtggtttgaaccccagaccttgcatatattatgcatt |
15155761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15170001 - 15169957
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
15170001 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
15169957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 15178773 - 15178729
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
15178773 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
15178729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 16204781 - 16204825
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16204781 |
tggtggtcgggatttgaaccccggaccttgcatacattatgcatt |
16204825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 24623308 - 24623352
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
24623308 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
24623352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29740552 - 29740508
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29740552 |
tggtggccggggtttgaaccccggaccttgcgtatattatgcatt |
29740508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 559 - 594
Target Start/End: Complemental strand, 291429 - 291394
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
291429 |
ggggtttgaaccccggaccttgcatatattatgcat |
291394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 551 - 594
Target Start/End: Complemental strand, 32621442 - 32621399
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
32621442 |
tggtggtcggggtttgaatcccggaccttacatatattatgcat |
32621399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 655742 - 655784
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
655742 |
gtggccggggttcgaaccccggaccttgcatatattatgcatt |
655784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 557 - 595
Target Start/End: Complemental strand, 9111111 - 9111073
Alignment:
| Q |
557 |
tcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9111111 |
tcggggttcgaaccccggaccttgcatatattatgcatt |
9111073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 14918293 - 14918335
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
14918293 |
gtggtcggggtttgaaccccagaccttgtatatattatgcatt |
14918335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Original strand, 2726415 - 2726452
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2726415 |
cggggttcgaaccccggaccttgcatatattatgcatt |
2726452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 554 - 595
Target Start/End: Complemental strand, 8809373 - 8809332
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
8809373 |
tggtcggggtttgaacctcggatcttgcatatattatgcatt |
8809332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 16390500 - 16390455
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16390500 |
ttggtggccgaggtttgaaccccggaccttacatatattatgcatt |
16390455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 553 - 590
Target Start/End: Original strand, 22792933 - 22792970
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22792933 |
gtggtcggggtttgaaccccggaccttacatatattat |
22792970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 551 - 592
Target Start/End: Complemental strand, 27834409 - 27834368
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
27834409 |
tggtggtccgggtttgaaccccagaccttgcatatattatgc |
27834368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 33976307 - 33976270
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33976307 |
cggggtttgaaccccggaccttgcatattttatgcatt |
33976270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 247729 - 247685
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
247729 |
tggtggccggggtttgaactccggaccttgcatattttatgcatt |
247685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 9367471 - 9367427
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
9367471 |
tggtggtcggggtttgaatcccagaccttgcatattttatgcatt |
9367427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 9392659 - 9392703
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
9392659 |
tggtagtcggggtttaaacctcggaccttgcatatattatgcatt |
9392703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 12184578 - 12184534
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
12184578 |
tggtggccgggatttgaaccacggaccttgcatatattatgcatt |
12184534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 563 - 595
Target Start/End: Complemental strand, 12215811 - 12215779
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12215811 |
tttgaaccccggaccttgcatatattatgcatt |
12215779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 18253338 - 18253374
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18253338 |
ggggtttgaaccctggaccttgcatatattatgcatt |
18253374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 23903298 - 23903342
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
23903298 |
tggtggtcggtgtttgaaccccgaacgttgcatatattatgcatt |
23903342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 24373709 - 24373745
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24373709 |
ggggtttgaacccctgaccttgcatatattatgcatt |
24373745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 27080689 - 27080733
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
27080689 |
tggtggtcggggtttgaatcccagagcttgcatatattatgcatt |
27080733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 27907942 - 27907986
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
27907942 |
tggtggccggggtttgaaccccagaccttgcatattttatgcatt |
27907986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 28231416 - 28231460
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
28231416 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcatt |
28231460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 28758281 - 28758325
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
28758281 |
tggtgttcggggtttgaacctcggactttgcatatattatgcatt |
28758325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29680658 - 29680614
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29680658 |
tggtggtcggagtttgaacaccgaaccttgcatatattatgcatt |
29680614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 32524411 - 32524455
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
32524411 |
tggtggttggggtttgaaccctggactttgcatatattatgcatt |
32524455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Original strand, 8637437 - 8637472
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8637437 |
gggtttgaacctcggaccttgcatatattatgcatt |
8637472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 590
Target Start/End: Complemental strand, 12440733 - 12440694
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
12440733 |
tggtggtcgaggtttgaaccccagaccttgcatatattat |
12440694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 552 - 595
Target Start/End: Complemental strand, 28898925 - 28898882
Alignment:
| Q |
552 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcatt |
28898882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 560 - 595
Target Start/End: Complemental strand, 31971590 - 31971555
Alignment:
| Q |
560 |
gggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31971590 |
gggtttgaacctcggaccttgcatatattatgcatt |
31971555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 551 - 589
Target Start/End: Complemental strand, 5267094 - 5267056
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
589 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5267094 |
tggtggtcggggtttgaattccggaccttgcatatatta |
5267056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 554 - 592
Target Start/End: Original strand, 17992344 - 17992382
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgc |
592 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17992344 |
tggtcggggttcaaaccccggaccttgcatatattatgc |
17992382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 553 - 595
Target Start/End: Original strand, 26356074 - 26356116
Alignment:
| Q |
553 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcatt |
26356116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 591
Target Start/End: Complemental strand, 26400936 - 26400894
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
26400936 |
gttggtggccggggttcaaaccccggaccttgcatatattatg |
26400894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 595
Target Start/End: Complemental strand, 32053860 - 32053814
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||| ||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
32053860 |
gttggtggccggagtttgaaccacgaaccttgcatatattatgcatt |
32053814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 566 - 595
Target Start/End: Complemental strand, 4450317 - 4450288
Alignment:
| Q |
566 |
gaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4450317 |
gaaccccggaccttgcatatattatgcatt |
4450288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Complemental strand, 8639105 - 8639072
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
8639105 |
gtttgaaccccggaccttgcatatactatgcatt |
8639072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 562 - 595
Target Start/End: Original strand, 19265526 - 19265559
Alignment:
| Q |
562 |
gtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
19265526 |
gtttgaaccccggaccttgcatattttatgcatt |
19265559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 34474298 - 34474253
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
34474298 |
ttggtggccggggttcgaaccatggaccttgcatatattatgcatt |
34474253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 554 - 594
Target Start/End: Original strand, 866279 - 866319
Alignment:
| Q |
554 |
tggtcggggtttgaaccccggaccttgcatatattatgcat |
594 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
866279 |
tggtcggggtttgaaccatgaaccttgcatatattatgcat |
866319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 2445369 - 2445325
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| |||||||| | |||| |||||||||||||| |
|
|
| T |
2445369 |
tggtggtcggggttcgaaccccgaatcttgtatatattatgcatt |
2445325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 3808117 - 3808153
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |
|
|
| T |
3808117 |
ggggtttgaatctcggaccttgcatatattatgcatt |
3808153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 5040824 - 5040864
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5040824 |
tggtggccggagtttgaacaccggaccttgcatatattatg |
5040864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 8138449 - 8138493
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
8138449 |
tggtggttgaggtttgaaccccagaccttacatatattatgcatt |
8138493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 10018469 - 10018425
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10018469 |
tggtggccggagtttgaaccccgaaccttacatatattatgcatt |
10018425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 11456367 - 11456410
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
11456367 |
tggtggccggggtttgaacccc-gaccttacatatattatgcatt |
11456410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 12232173 - 12232217
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
12232173 |
tggtggtcggggttcgaaccccagacactgcatatattatgcatt |
12232217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 12323481 - 12323525
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||| | |||||| |||||||||||||| |
|
|
| T |
12323481 |
tggtggtcggtgtttgaaccctgaaccttgtatatattatgcatt |
12323525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 12582220 - 12582264
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
12582220 |
tggtggccggggtttgaactccagaccttgcatattttatgcatt |
12582264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 12591018 - 12591062
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
12591018 |
tggtggttggggtttaaatcccgaaccttgcatatattatgcatt |
12591062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 12808931 - 12808895
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12808931 |
ggggttcgaaccccagaccttgcatatattatgcatt |
12808895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 13583619 - 13583575
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| | || |||||||||||||| |||| |
|
|
| T |
13583619 |
tggtggtcggggtttgaacctctgagcttgcatatattatacatt |
13583575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 14296948 - 14296988
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||| ||||| |
|
|
| T |
14296948 |
tggtggccggggtttgaaccccggaccttacatattttatg |
14296988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 17113451 - 17113495
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
17113451 |
tggtggtcgaagtttgaacctcagaccttgcatatattatgcatt |
17113495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 17151306 - 17151266
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
17151306 |
tggtggccgaggtttgaaccccagaccttgcatatattatg |
17151266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 17935799 - 17935755
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
17935799 |
tggtggtcgggatttgaaccctagaccttgcatattttatgcatt |
17935755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 21029369 - 21029401
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
21029369 |
tttgaaccccgaaccttgcatatattatgcatt |
21029401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 21599027 - 21598987
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
21599027 |
tggtggccggggtttaaaccccgtaccttgcatatattatg |
21598987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Complemental strand, 24248235 - 24248195
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
24248235 |
tggtggtcgagggttgaaccccggaccttacatatattatg |
24248195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 26548313 - 26548277
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
26548313 |
ggggtttgaaccccgaaccttgcatatattatacatt |
26548277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 27080795 - 27080839
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
27080795 |
tggtggtcggggtttgaattccagagcttgcatatattatgcatt |
27080839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 587
Target Start/End: Original strand, 28989302 - 28989338
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatat |
587 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28989302 |
tggtggtcggggttcgaaccccgtaccttgcatatat |
28989338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 29283885 - 29283841
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
29283885 |
tggtggtcggagtttgaaccctagaccttgcatatattatacatt |
29283841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 34701217 - 34701173
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
34701217 |
tggtggccggagtttgaacctcagaccttgcatatattatgcatt |
34701173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 550 - 595
Target Start/End: Complemental strand, 64289 - 64244
Alignment:
| Q |
550 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
64289 |
ttggtggtcggggttcgaatcccggaccttgcatatattatgcatt |
64244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 1164 - 1200
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1164 |
ggggtttgaaccccggaccttgcatatattatgcatt |
1200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 53371 - 53415
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
53371 |
tggtggtcggggtttgaaccccagaccttgcatattttatgcatt |
53415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 161211 - 161167
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
161211 |
tggtggtcggggtttgaaccccgaaccttgcatattttatgcatt |
161167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1619 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold1619
Description:
Target: scaffold1619; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 1093 - 1057
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1093 |
ggggtttgaatcccggaccttgcatatattatgcatt |
1057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 5252 - 5208
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
5252 |
tggtggttggggtttgaacctcagaccttgcatatattatgcatt |
5208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 14177 - 14221
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
14177 |
tggtggtcggggtttgaaccacataccttgcatatattatgcatt |
14221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 31913 - 31957
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
31913 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcatt |
31957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 75395 - 75351
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
75395 |
tggtggccgggattcgaaccccggaccttgcatatattatgcatt |
75351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 99107 - 99063
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
99107 |
tggttgtcggagtttgaaccccagaccttgcatatattatgcatt |
99063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 7792 - 7748
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | ||||||||| |
|
|
| T |
7792 |
tggtggtcggggtttgaacctcggaccttgcatgttttatgcatt |
7748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 185326 - 185289
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
185326 |
cggggtttgaaccccggatcttgcatattttatgcatt |
185289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 551 - 590
Target Start/End: Complemental strand, 53495 - 53456
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
590 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
53495 |
tggtggtcggggtttgaatcccggaccttgcatatgttat |
53456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 556 - 595
Target Start/End: Original strand, 72771 - 72810
Alignment:
| Q |
556 |
gtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
72771 |
gtcggagtttgaaccctggaccttgcatatattatgcatt |
72810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 549 - 595
Target Start/End: Complemental strand, 48719 - 48673
Alignment:
| Q |
549 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
48719 |
gttggtgtccggggtttgaatcccggactttgcatatattatgcatt |
48673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 22974 - 22937
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
22974 |
cggggtttgaacctcggaccttgcatattttatgcatt |
22937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 558 - 595
Target Start/End: Complemental strand, 239870 - 239833
Alignment:
| Q |
558 |
cggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
239870 |
cggggtttgaactccggactttgcatatattatgcatt |
239833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1120 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold1120
Description:
Target: scaffold1120; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 1975 - 1939
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
1975 |
ggggtttgaaccacgaaccttgcatatattatgcatt |
1939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 1590 - 1554
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1590 |
ggggttcgaaccccggaccttgcatattttatgcatt |
1554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 14807 - 14851
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
14807 |
tggtggccggggttcaaaccccggaccttgcatattttatgcatt |
14851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Original strand, 15929 - 15965
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
15929 |
ggggtttgaaccccagaccttgcatatattatacatt |
15965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 5483 - 5439
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||| | ||||||| |||||||||||| ||||||||| |
|
|
| T |
5483 |
tggtggtcggggatcgaaccccagaccttgcatattttatgcatt |
5439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 559 - 595
Target Start/End: Complemental strand, 25451 - 25415
Alignment:
| Q |
559 |
ggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
25451 |
ggggttcgaaccctggaccttgcatatattatgcatt |
25415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 37605 - 37561
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
37605 |
tggtggccgggattcgaaccccggaccttgcatattttatgcatt |
37561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Complemental strand, 39454 - 39410
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||| ||| ||||| |
|
|
| T |
39454 |
tggtggtcggggtttgaaccccagaccttacatattttaagcatt |
39410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 563 - 595
Target Start/End: Original strand, 42337 - 42369
Alignment:
| Q |
563 |
tttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
42337 |
tttgaaccccagaccttgcatatattatgcatt |
42369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 555 - 595
Target Start/End: Original strand, 91174 - 91214
Alignment:
| Q |
555 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
91174 |
ggtcgaggttcgaaccccggacattgcatatattatgcatt |
91214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 73511 - 73555
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||| | |||||||| |
|
|
| T |
73511 |
tggtggtcggagtttgaaccccggacattgcatacactatgcatt |
73555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 595
Target Start/End: Original strand, 61561 - 61605
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
595 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
61561 |
tggtggccggggtttgaaccctggaccttacatacattatgcatt |
61605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 551 - 591
Target Start/End: Original strand, 221004 - 221044
Alignment:
| Q |
551 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
591 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
221004 |
tggtggtcggggtttgaaccctagactttgcatatattatg |
221044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University