View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21125_high_13 (Length: 250)
Name: NF21125_high_13
Description: NF21125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21125_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 26893952 - 26893739
Alignment:
| Q |
16 |
atctatctatggagattttgatgcagttattgttgcttgagttttgttgttggtggtttcattacaattttttcagatggaatggcagatcctgctagta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26893952 |
atctatctatggagattttgatgcagttattgttgcttgagctttgttgttggtggtttcattacaattttttcagatggaatggcagatcctgctagta |
26893853 |
T |
|
| Q |
116 |
atggaggtcttgagcgagatattgaacaagttggtttaacttttcctctaaattatgctactcaaataccttgcatgtagatagtgatgctgtaaattaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
26893852 |
atggaggtcttgagcgagatattgaacaagttggtttaacttttcctcgaaattatgctactcaaataccttgcatgtagatagttatggtgtaaattaa |
26893753 |
T |
|
| Q |
216 |
gaaattgtttatat |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26893752 |
gaaattgtttatat |
26893739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 109
Target Start/End: Original strand, 16011859 - 16011900
Alignment:
| Q |
69 |
tggtttcattacaattt-tttcagatggaatggcagatcctg |
109 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
16011859 |
tggtttccttacaatttctttcagatggaatggcagatcctg |
16011900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University