View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21125_high_14 (Length: 238)
Name: NF21125_high_14
Description: NF21125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21125_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 13024058 - 13023837
Alignment:
| Q |
2 |
gaggttctagggtggaccaccttgatatatattaaaaggtgaactagtactaaaaaatcactatcctcatcttacggatgagctggtgatctatcagcgt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13024058 |
gaggttctagggtggaccaccttgatatatattcaaaggtgaactagtactaaaaaatcactatcctcatcttacggatgagctggtgatctatcagcgt |
13023959 |
T |
 |
| Q |
102 |
tggttcgacaaaaacaagaaaacatgaatatgagtttaattttgaggcacacttgaccgttttcttttgtttttgctgaactgacgccaatgaagtcaac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13023958 |
tggttcgacaaaaacaagaaaacatgaatatgagtttaattttgaggcacacttgaccgttttcttttgtttttgctgaactgacaccaatgaagtcaac |
13023859 |
T |
 |
| Q |
202 |
atttcatccctaaggacaaatg |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13023858 |
atttcatccctaaggacaaatg |
13023837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 4095696 - 4095651
Alignment:
| Q |
108 |
gacaaaaacaagaaaacatgaatatgagtttaattttgaggcacac |
153 |
Q |
| |
|
||||||||| || ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
4095696 |
gacaaaaacgaggaaaaatgaatatgagttgaattttgaggcacac |
4095651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University