View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21125_high_4 (Length: 427)
Name: NF21125_high_4
Description: NF21125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21125_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 49271387 - 49271470
Alignment:
| Q |
16 |
aatatatagcaatagtatatacaattgaatttgaggaggtgaaaaggnnnnnnnttgaatgactcaattaaacctccattcacc |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49271387 |
aatatatagcaatagtataaacaattgaatttgaggaggtgaaaaggaaaaaaattgaatgactcaattaaacctccattcacc |
49271470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 238 - 301
Target Start/End: Original strand, 3470457 - 3470520
Alignment:
| Q |
238 |
tatatttatatttttaaaaatgaaatgtttgcctaaactacttcaaaatcctgggtccgtccct |
301 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
3470457 |
tatatttatgtttttcaaaatgaaatgtttgcctacactacttaaaaatcctgggtccgtccct |
3470520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 243 - 301
Target Start/End: Original strand, 17366304 - 17366362
Alignment:
| Q |
243 |
ttatatttttaaaaatgaaatgtttgcctaaactacttcaaaatcctgggtccgtccct |
301 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| ||||||| |||||||||| ||||||||| |
|
|
| T |
17366304 |
ttatgtttttaaaaatgaaatgtttgtctacactacttaaaaatcctggatccgtccct |
17366362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 301
Target Start/End: Original strand, 31152538 - 31152602
Alignment:
| Q |
237 |
gtatatttatatttttaaaaatgaaatgtttgcctaaactacttcaaaatcctgggtccgtccct |
301 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| ||| ||| ||||| ||||||||||||| |
|
|
| T |
31152538 |
gtatatttatgtttttaagaatgaaatgtttgcctacactgcttaaaaattttgggtccgtccct |
31152602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 237 - 301
Target Start/End: Original strand, 8760543 - 8760607
Alignment:
| Q |
237 |
gtatatttatatttttaaaaatgaaatgtttgcctaaactacttcaaaatcctgggtccgtccct |
301 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| ||| || |||||| ||| ||| ||||| |
|
|
| T |
8760543 |
gtatatttatgtttttaagaatgaaatgtttgcctacactgtttaaaaatcatggatccatccct |
8760607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University