View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21125_low_11 (Length: 303)
Name: NF21125_low_11
Description: NF21125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21125_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 73 - 285
Target Start/End: Complemental strand, 52608937 - 52608725
Alignment:
| Q |
73 |
cataaaacatatgtacaatgcaaaacaaaaacacagatgtacaactttttgaacaatattttttgtaaaggctatttacctcattctatggggctttgga |
172 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52608937 |
cataaaacatatgtacaatgtaaaacaaaaacacagatgtacaactttttgaacaatattttttgtaaaggctatttacctcattctatggggctttgga |
52608838 |
T |
|
| Q |
173 |
agtctgaaaacgatgataattgacatatgccggctatattgtttcggtgtttttgtaaattcagttaaactgcacatacaaattattaacttttaaatgt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52608837 |
agtctgaaaacgatgataattgacatatgccggctatcttgtttcggtgtttttgtaaattcagttaaactgcacatacaaattattaacttttaaatgt |
52608738 |
T |
|
| Q |
273 |
ttgcccataatta |
285 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52608737 |
ttgcccataatta |
52608725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 52609023 - 52608960
Alignment:
| Q |
13 |
aatatctcttttgttttaccggaacagtataactactattttatcgtaattcactcgcagcata |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52609023 |
aatatctcttttgttttaccggaacagtatatctactattttatcgtaattcactcgcagcata |
52608960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University