View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21125_low_8 (Length: 317)
Name: NF21125_low_8
Description: NF21125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21125_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 52 - 290
Target Start/End: Original strand, 47004124 - 47004369
Alignment:
| Q |
52 |
actgtagtgcatttgcatttgatctattataaaatcaagctagaaagtcaaattttgagtatctatctttcttctatatat------gcaccggtatatg |
145 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47004124 |
actgtattgcatttgcatttgagctattataaaatcaagctagaaagtcaaattttgagtatctatctttcttctatatatatatatgcaccggtatatg |
47004223 |
T |
 |
| Q |
146 |
annnnnnn-acacaacacaatagaggacgaggtttggatcaaattataataatgatgacaaactctccatagtcctaaggttgctggaatattactcatc |
244 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47004224 |
aggggggggacacaacacaatagaggacgaggtttggatcaaattataataatgatgacaaactctccatagtcctaaggttgctggaatattactcatc |
47004323 |
T |
 |
| Q |
245 |
aatcaatcaaactacagttgcaggtgattccactttggttccatgg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47004324 |
aatcaatcaaactacagttgcaggtgattccactttggttccatgg |
47004369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University