View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21126_high_6 (Length: 267)
Name: NF21126_high_6
Description: NF21126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21126_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 33740177 - 33739976
Alignment:
| Q |
1 |
tcatcaaagtactatcaaccattagtctttgtaatgtgatcctattcatgaagattgtaaccaaaacctttgctaaccgcctcaagtttattctct---t |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33740177 |
tcatcaaagtactatcaaccattagtctttgtaatgtgatcctattcatgaagattgtaaccaaaacctttgctaaccgcctcaagtttattctctctat |
33740078 |
T |
 |
| Q |
98 |
cattgatgaggaacaaagcgct-------taatgcctaacattcaaataaattaatgtaacttaaattaaattaaaatgctagggcgccgcagataattt |
190 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33740077 |
cattgatgaggaacaaagcgcttataaaataatgcctaacattcaaataaattaatgtaacttaaattaaattaaaatgctagggcgccgcagataattt |
33739978 |
T |
 |
| Q |
191 |
at |
192 |
Q |
| |
|
|| |
|
|
| T |
33739977 |
at |
33739976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University