View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21126_low_12 (Length: 225)
Name: NF21126_low_12
Description: NF21126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21126_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45672720 - 45672938
Alignment:
| Q |
1 |
ctttgtcattgctgttgaaatcaccgagacaaacagcacattgtagaggatcttcaacactttcattaaaatgtttgatgatggtagagtaaagtaagat |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45672720 |
ctttgtcattgttgttgaaatcaccgagacaaacagcacattgtagaggatcttcaatactttcattaaaatgtttgatgatggtagagtaaagtaagat |
45672819 |
T |
 |
| Q |
101 |
tgggaaagttttgagaagttgagggttgatacctttgtcactttcacattttgatgagtctgcccttaacgagtttgtgaagccgcgtactaacgttatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45672820 |
tgggaaagttttgagaagttgagggttgatacctttgtcactttcacattttgatgagtctgcccttaacgagtttgtgaagccgcgtattaacgttatg |
45672919 |
T |
 |
| Q |
201 |
aagagaaaaagtaagataa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45672920 |
aagagaaaaagtaagataa |
45672938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University