View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21126_low_7 (Length: 263)
Name: NF21126_low_7
Description: NF21126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21126_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 80 - 247
Target Start/End: Original strand, 10248433 - 10248600
Alignment:
| Q |
80 |
agagattggttgttttgtgattaccatagcaagccaagaatctgcatcaacctgccatggaagtatatgggaaagtgtatgccacaaccagtaaaaggaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10248433 |
agagattggttgttttgtgattaccatagcaagccaagaatctgcatcaacctgccatggaagtatatgggaaagtgtatgccacaaccagtaaaaggaa |
10248532 |
T |
|
| Q |
180 |
ttatgcatatatcagaattgacactgcttgtttctgaatgtgcatatcagaattatgtagatacttag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10248533 |
ttatgcatatatcagaattgacactgcttgtttctgaatgtgcatataagaattatgtagatacttag |
10248600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 10244544 - 10244625
Alignment:
| Q |
1 |
aattaagttgttctaacgcatgcaaaattgatggttgaatttggccaatcaattgatatagccatgtcttgaaataaataga |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244544 |
aattaagttgttctaacgcatgcaaaattgatggctgaatttggccaatcaattgatatagccatgtcttgaaataaataga |
10244625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University