View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21127_high_1 (Length: 409)
Name: NF21127_high_1
Description: NF21127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21127_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 144 - 395
Target Start/End: Original strand, 37397503 - 37397754
Alignment:
| Q |
144 |
ttgccattatccttgatgctgcatctgtaaatagcagaacttttgttgttggttgaatttgcagtgttgcattatccatgagatattgcaaggcatgcaa |
243 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37397503 |
ttgccattatccttgatactgcatctgtaaatagcagaacttttgttgttggttgaatttgcagtgttgcattatccatgagatattgcaaggcatgcaa |
37397602 |
T |
 |
| Q |
244 |
tgaaattgttgcttgctccaagatcaaacaaggctttggcaaacatgaccccgctgataataatcggtaatgtaacccttcatggatccctacactttga |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37397603 |
tgaaattgttgcttgctccaagatcaaacaaggctttggcaaacatgaccccgctgataacaatcggtaatgtaacccttcatggatccctacacttcga |
37397702 |
T |
 |
| Q |
344 |
tgattatcacggtatgcagtgtttccaaggtactctcgactgcttttcatct |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37397703 |
tgattatcacggtatgcagtgtttccaaggtactctcgactgcttttcatct |
37397754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University