View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21127_high_4 (Length: 269)
Name: NF21127_high_4
Description: NF21127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21127_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 20 - 139
Target Start/End: Complemental strand, 29766626 - 29766507
Alignment:
| Q |
20 |
atccaaggcagcaatttgctgctaggtttcccaacatgtctcctggtgctgttgatttgttagagaggatgcttgtttttgatccaaacaggcgcattac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766626 |
atccaaggcagcaatttgctgctaggtttcccaacatgtctcctggtgctgttgatttgttagagaggatgcttgtttttgatccaaacaggcgcattac |
29766527 |
T |
|
| Q |
120 |
aggtaaactcatatgtttga |
139 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29766526 |
aggtaaactcatatgtttga |
29766507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 209 - 253
Target Start/End: Complemental strand, 29766442 - 29766398
Alignment:
| Q |
209 |
gttgacgaggctctgcgtcaccaatacttggcacctctccatgat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766442 |
gttgacgaggctctgcgtcaccaatacttggcacctctccatgat |
29766398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 11060271 - 11060356
Alignment:
| Q |
41 |
ctaggtttcccaacatgtctcctggtgctgttgatttgttagagaggatgcttgtttttgatccaaacaggcgcattacaggtaaa |
126 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |||||| |||||| | |||||||||| || |||||||| ||||||| |
|
|
| T |
11060271 |
ctaggtttcccagcatgtctccaggtgctgttgatttgctagagaaaatgcttatctttgatccaagcaagcgcattagaggtaaa |
11060356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University