View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21127_high_9 (Length: 239)
Name: NF21127_high_9
Description: NF21127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21127_high_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 29766845 - 29766607
Alignment:
| Q |
1 |
cacagaggtaataatagatataggtcatgcattttgctttaaatgttgcaaattatgtcatattctttgatccttttcagacttgagccatcttgaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766845 |
cacagaggtaataatagatataggtcatgcattttgctttaaatgttgcaaattatgtcacattctttgatccttttcagacttgagccatcttgaaatt |
29766746 |
T |
 |
| Q |
101 |
tgattttagtttgacaaattttctttgattcaaaaagctcataggttcgcctgatgacgccagccttggatttatacgaagtgataatgctcgtagatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766745 |
tgattttagtttgacaaattttctttgattcaaaaagctcataggttcgcctgatgacgccagccttggatttatacgaagtgataatgctcgtagatat |
29766646 |
T |
 |
| Q |
201 |
gtaaaacagcttcctcaatatccaaggcagcaatttgct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766645 |
gtaaaacagcttcctcaatatccaaggcagcaatttgct |
29766607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 136 - 224
Target Start/End: Original strand, 11060166 - 11060254
Alignment:
| Q |
136 |
agctcataggttcgcctgatgacgccagccttggatttatacgaagtgataatgctcgtagatatgtaaaacagcttcctcaatatcca |
224 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||| ||| ||||| ||||||||| |
|
|
| T |
11060166 |
agctgataggttcacctgatgatgccagccttggatttctacgcagtgagaatgctcgtagatacgtaagacaacttccacaatatcca |
11060254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University