View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21127_low_5 (Length: 263)
Name: NF21127_low_5
Description: NF21127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21127_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 59 - 260
Target Start/End: Original strand, 41004616 - 41004817
Alignment:
| Q |
59 |
ttcgcaccgtcgttgaaaacggtccctcccgtttcatctccttcgtcgacggcgatccctccgttaaatctctactttcccgtcttgaccttgccggtaa |
158 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41004616 |
ttcgcaccgtcgttgaaaacggtacctcacgtttcatctcctttgtcgacggcgatccctccgttaaatctctactttcccgtcttgaccttgccggtaa |
41004715 |
T |
 |
| Q |
159 |
cgccgttaacgctgctaattatcgacaccgtcaacgttcttctcagtttcatccttctccagctgctcttcgccgtcgtcgtccttttcttcatctcact |
258 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41004716 |
cgccgttaacgctgctaattatcaacaccgtcaacgttcttctcagtttcatccttctccagctgctcttcgccgtcgtcgtccttttcttcatctcact |
41004815 |
T |
 |
| Q |
259 |
cg |
260 |
Q |
| |
|
|| |
|
|
| T |
41004816 |
cg |
41004817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University