View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21127_low_7 (Length: 250)
Name: NF21127_low_7
Description: NF21127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21127_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 49397259 - 49397031
Alignment:
| Q |
19 |
tgtcaagctgaccttttattacctaacttgtttattattt-attcagagatgttctcaggtctcttgatcaaggcacaagaggataattttcttcatgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49397259 |
tgtcaagctgaccttttattacctaacttgtttattattttattcagagatgttctcaggtctcttgatcaaggcacaagaggaaaattttcttcatgat |
49397160 |
T |
 |
| Q |
118 |
attcaaattgcaagggatgctcatgatagcttcatattttgcaaggcaaataaataaggcagcctccaattagcatatcaatttggacaaacttgacatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49397159 |
attcaaattgcaagggatgctcatgatagcttcatattttgcaaggcaa----ataaggcagcctccaattagcatatcaatttggacaaacttgacatt |
49397064 |
T |
 |
| Q |
218 |
ttcaaactctcatttaaacatgagtttgaattt |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
49397063 |
ttcaaactctaatttaaacatgagtttgaattt |
49397031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University