View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_high_15 (Length: 374)
Name: NF21128_high_15
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 59 - 294
Target Start/End: Complemental strand, 38492749 - 38492507
Alignment:
| Q |
59 |
tgtttcattgatatgatggtgggttttgttttgttttg-----caacaaacagtgacaaaaattgaaatttgttgaaccgtactagtagagtagtagcag |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38492749 |
tgtttcattgatatgatggtgggttttgttttgttttgttttgcaacaaacagtgacaaaaattgaaatttgttgaaccgtactagtagagtagtagcag |
38492650 |
T |
|
| Q |
154 |
aatagtacctatctatctctcttctttccact--nnnnnnnnnnnnnttgttgagnnnnnnncaaattagagaaacaaacagctgtttataaataaactt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38492649 |
aatagtacctatctatctctcttctttccactcacacacacacacacttgttgagaaaaaaacaaattagagaaacaaacagctgtttataaataaactt |
38492550 |
T |
|
| Q |
252 |
tatagtgtttccccagtggacagctcagcatcaatacaagaat |
294 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38492549 |
tatagtgtttcaccagtggacagctcagcatcaatacaagaat |
38492507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University