View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_high_17 (Length: 339)
Name: NF21128_high_17
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 31 - 261
Target Start/End: Complemental strand, 41739781 - 41739551
Alignment:
| Q |
31 |
tcttttaatttcctgcattttctactttagttatgtgtggcgtaacattcgttcttctcaaattttgatggagagaggctatatatgaaaaattggagat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41739781 |
tcttttaatttcctgcattttctactttagttatgtgtggcgtaacattcgttcttctcaaattttgatggagagaggctatatatgaaaaattggagat |
41739682 |
T |
 |
| Q |
131 |
ggttctctattgaacattggtcatacttcatcgctcaggtgtaaggttgatcctagggctatcatgccatcaactcagtttggctcgaacatgcagatta |
230 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41739681 |
ggttctctagtgaacattggtcatacttcatcgctcaggtgtaaggttgatcctagggccatcatgccatcaactcagtttggctcgaacatgcagatta |
41739582 |
T |
 |
| Q |
231 |
gagctcttatagatgaaaatattggaagatg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41739581 |
gagctcttatagatgaaaatattggaagatg |
41739551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University