View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_high_19 (Length: 330)
Name: NF21128_high_19
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 241 - 312
Target Start/End: Complemental strand, 16302187 - 16302116
Alignment:
| Q |
241 |
aaactatatgagcataagtttaccgtgtgtttcaactaggaatcagaacatgacaactttgaacattaaaat |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16302187 |
aaactatatgagcataaatttaccgtgtgtttcaactaggaatcagaacatgacaactttgaacattaaaat |
16302116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 105 - 157
Target Start/End: Complemental strand, 29429539 - 29429487
Alignment:
| Q |
105 |
taattagtagattacggaaatgcccttcaggagggcaaaattgaaaaattaac |
157 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
29429539 |
taattagaagattaccaaaatgcccttcagaagggcaaaatggtaaaattaac |
29429487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University