View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_high_27 (Length: 275)
Name: NF21128_high_27
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 267
Target Start/End: Complemental strand, 43735821 - 43735571
Alignment:
| Q |
17 |
acactgccaacattatgaagacaccgaacgaacctgctggaatttcaaagtttgaagtgatgtgtctgtccatggtttgggcttgtagcaaatgatatga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43735821 |
acactgccaacattatgaagacaccgaacgatcctgctggaatttcaaagtttgaagtgatgtgtctgtccatggtttgggcttgtagcaaatgatatga |
43735722 |
T |
 |
| Q |
117 |
ggattggctactgctaactgacaccatgatacttgaagaccaaatgggaatgattttgatgatggcttttagctcttcaacttgatctattgtacataga |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43735721 |
ggactggctactgctaactgacaccatgatacttgaagaccaaatgggaatgattttgatgatggcttttagctcttcaacttgatctattgtacataga |
43735622 |
T |
 |
| Q |
217 |
ttccatctctttgaggctgatccatcagaggctatatctttttctttgtct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43735621 |
ttccatctctttgaggctgatccatcagaggctatatctttttctttgtct |
43735571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 256
Target Start/End: Complemental strand, 43703608 - 43703530
Alignment:
| Q |
178 |
atggcttttagctcttcaacttgatctattgtacatagattccatctctttgaggctgatccatcagaggctatatctt |
256 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||| |||| | ||| ||||| ||||| ||||||||||||| |
|
|
| T |
43703608 |
atggcttttagttcttcaacttgatctactgtgcatagactccaacgatttatcgctgaaccatctgaggctatatctt |
43703530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 256
Target Start/End: Complemental strand, 43714579 - 43714501
Alignment:
| Q |
178 |
atggcttttagctcttcaacttgatctattgtacatagattccatctctttgaggctgatccatcagaggctatatctt |
256 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||| |||| | ||| ||||| ||||| ||||||||||||| |
|
|
| T |
43714579 |
atggcttttagttcttcaacttgatctactgtgcatagactccaacgatttatcgctgaaccatctgaggctatatctt |
43714501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University