View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21128_high_27 (Length: 275)

Name: NF21128_high_27
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21128_high_27
NF21128_high_27
[»] chr2 (3 HSPs)
chr2 (17-267)||(43735571-43735821)
chr2 (178-256)||(43703530-43703608)
chr2 (178-256)||(43714501-43714579)


Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 267
Target Start/End: Complemental strand, 43735821 - 43735571
Alignment:
17 acactgccaacattatgaagacaccgaacgaacctgctggaatttcaaagtttgaagtgatgtgtctgtccatggtttgggcttgtagcaaatgatatga 116  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43735821 acactgccaacattatgaagacaccgaacgatcctgctggaatttcaaagtttgaagtgatgtgtctgtccatggtttgggcttgtagcaaatgatatga 43735722  T
117 ggattggctactgctaactgacaccatgatacttgaagaccaaatgggaatgattttgatgatggcttttagctcttcaacttgatctattgtacataga 216  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43735721 ggactggctactgctaactgacaccatgatacttgaagaccaaatgggaatgattttgatgatggcttttagctcttcaacttgatctattgtacataga 43735622  T
217 ttccatctctttgaggctgatccatcagaggctatatctttttctttgtct 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
43735621 ttccatctctttgaggctgatccatcagaggctatatctttttctttgtct 43735571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 256
Target Start/End: Complemental strand, 43703608 - 43703530
Alignment:
178 atggcttttagctcttcaacttgatctattgtacatagattccatctctttgaggctgatccatcagaggctatatctt 256  Q
    ||||||||||| |||||||||||||||| ||| |||||| |||| |  |||   ||||| ||||| |||||||||||||    
43703608 atggcttttagttcttcaacttgatctactgtgcatagactccaacgatttatcgctgaaccatctgaggctatatctt 43703530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 256
Target Start/End: Complemental strand, 43714579 - 43714501
Alignment:
178 atggcttttagctcttcaacttgatctattgtacatagattccatctctttgaggctgatccatcagaggctatatctt 256  Q
    ||||||||||| |||||||||||||||| ||| |||||| |||| |  |||   ||||| ||||| |||||||||||||    
43714579 atggcttttagttcttcaacttgatctactgtgcatagactccaacgatttatcgctgaaccatctgaggctatatctt 43714501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University