View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_high_36 (Length: 246)
Name: NF21128_high_36
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_high_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 9 - 181
Target Start/End: Original strand, 9536129 - 9536301
Alignment:
| Q |
9 |
gagatgaaacaaaatttgtgtagtataagaggaggattcttggtaaattttcccacccaataatgcaatactcagaaaaagatcttgataacattgtcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9536129 |
gagatgaaacaaaatttgtgtagtataagaggaggattcttggtaaattttcccacccaataatgcaatactcagaaaaagatcttgataacattgtcca |
9536228 |
T |
|
| Q |
109 |
agctgaacctattttgaataaaaataacaagttaatgaatgattggaagttcaactcaataaaattagagaaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9536229 |
agctgaacctattttgaataaaaataacaagttaatgaatgattggaagttcaactcaataaaattagagaaa |
9536301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 118
Target Start/End: Complemental strand, 33720491 - 33720428
Alignment:
| Q |
55 |
attttcccacccaataatgcaatactcagaaaaagatcttgataacattgtccaagctgaacct |
118 |
Q |
| |
|
||||||||| || || ||||||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
33720491 |
attttcccatcccatgatgcaatactcagaaaatgatcttgatactattgtccatgctgaacct |
33720428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University