View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_high_40 (Length: 238)
Name: NF21128_high_40
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 44423578 - 44423794
Alignment:
| Q |
5 |
atattaaaatttgttttaagtctcaacnnnnnnnntaaaatttattgggtcggtctagctctcattcctcgttgccattatctgttgccgatgttaactt |
104 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
44423578 |
atattaaaatttgttttaaatctcaacaaaaaaa-taaaatttattgggtcggtctagctctcattcctcgttgccattagctgttgccaatgttaactt |
44423676 |
T |
 |
| Q |
105 |
acaagttacagcaagattatttttacaagtcagaaattgttatagcaagattatttttacaaatcagaaattaattgctaaagatttgccacttttggga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44423677 |
acaagttacagcaagattatttttacaaatcagaaattgttacagcaagattatttttacaaatgagaaattaattgctaaagatttgccacttttggga |
44423776 |
T |
 |
| Q |
205 |
tttatagagttgtgttat |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44423777 |
tttatagagttgtgttat |
44423794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University