View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_high_42 (Length: 210)
Name: NF21128_high_42
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 2905084 - 2905248
Alignment:
| Q |
7 |
tattattctcaattttaattaaattaatgaatgtcgtctaaggatgttgtattcaaataaacacaagaaaggagggctgagggtttaatgtgttggcttt |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2905084 |
tattattctcaattttaattaaa---atgaatgtcgtctaaggatgttgtattcaaataaacacaagaaaggagggctgagtgtttaatgtgttggcttt |
2905180 |
T |
 |
| Q |
107 |
ttctgaaaatatattcgaagttaaatacatatcacaagcaagaaagaaagcagcagaggaagagagag |
174 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2905181 |
ttgtgaaaatatattcgaagttaaatacatatcagaagcaagaaagaaagcagcagaggaagagagag |
2905248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University