View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_low_15 (Length: 398)
Name: NF21128_low_15
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 13 - 176
Target Start/End: Original strand, 41320443 - 41320609
Alignment:
| Q |
13 |
taggtaattgaaacgaagaggatgagtaagaggagaagcttgtgggagattttggattgtgtagttgtagttgttgttact---actacacctccattgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
41320443 |
taggtaattgaaacgaagaggatgagtaagaggagaagcttgtgggagattttggattgtgtagttgttgttgttgttgttgttactacacctccattgg |
41320542 |
T |
 |
| Q |
110 |
aaagaggggtaccgacggcagatttaggagtccagattagtttatctgaatctttcatgtttgtagg |
176 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320543 |
aaagaggggtgccgacggcagatttaggagtccagattagtttatctgaatctttcatgtttgtagg |
41320609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 254 - 375
Target Start/End: Original strand, 41320682 - 41320799
Alignment:
| Q |
254 |
gaggtgaggtgaatttgaaggaagcagatcttgaaatctagtaatagaaatagatagaatgattggaagagatgaatgtagtagggtaagataattaaag |
353 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320682 |
gaggtgaggagaatttgaaggaagcagatcttgcaatctagtaatagaaatag----aatgattggaagagatgaatgtagtagggtaagataattaaag |
41320777 |
T |
 |
| Q |
354 |
gcggtgagaaatagaaggaagg |
375 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
41320778 |
gcggtgagaaatagaaagaagg |
41320799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University