View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21128_low_17 (Length: 374)

Name: NF21128_low_17
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21128_low_17
NF21128_low_17
[»] chr3 (1 HSPs)
chr3 (59-294)||(38492507-38492749)


Alignment Details
Target: chr3 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 59 - 294
Target Start/End: Complemental strand, 38492749 - 38492507
Alignment:
59 tgtttcattgatatgatggtgggttttgttttgttttg-----caacaaacagtgacaaaaattgaaatttgttgaaccgtactagtagagtagtagcag 153  Q
    ||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38492749 tgtttcattgatatgatggtgggttttgttttgttttgttttgcaacaaacagtgacaaaaattgaaatttgttgaaccgtactagtagagtagtagcag 38492650  T
154 aatagtacctatctatctctcttctttccact--nnnnnnnnnnnnnttgttgagnnnnnnncaaattagagaaacaaacagctgtttataaataaactt 251  Q
    ||||||||||||||||||||||||||||||||               ||||||||       ||||||||||||||||||||||||||||||||||||||    
38492649 aatagtacctatctatctctcttctttccactcacacacacacacacttgttgagaaaaaaacaaattagagaaacaaacagctgtttataaataaactt 38492550  T
252 tatagtgtttccccagtggacagctcagcatcaatacaagaat 294  Q
    ||||||||||| |||||||||||||||||||||||||||||||    
38492549 tatagtgtttcaccagtggacagctcagcatcaatacaagaat 38492507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University