View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_low_18 (Length: 361)
Name: NF21128_low_18
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 13 - 342
Target Start/End: Original strand, 40247830 - 40248159
Alignment:
| Q |
13 |
acgatgaatatgcttattcctctaaattctggtctgatgagttttacgctgcttggaaggattggattcttccgcacgatgctgtttcggttaccgagga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40247830 |
acgatgaatatgcttattcctctaaattctggtctgatgagttttacgctgcttggaaggattggattcttcctcacgatgctgtttcggttaccgagga |
40247929 |
T |
 |
| Q |
113 |
tggtgttggtaggtttaattcgagttctaaaggtagggtttgctttggagttaaccgtacggtgagtttagctccgattgttactttgtcttcggttact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40247930 |
tggtgttggtaggtttaattcgagttctaaaggtagggtttgctttggagttaaccgtacggtgagtttagctccgattgttactttgtcttcggttact |
40248029 |
T |
 |
| Q |
213 |
gattccaagtttaagtttagttatgttgcttgggttatcaagtgtttggaggggatgaatgaggttgtgggagaggggttaggtttgattctagaagctt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40248030 |
gattccaagtttaagtttagttatgttgcttgggttatcaagtgtttggaggggatgaatgaggttgtgggagaggggttaggtttgattctagaagctt |
40248129 |
T |
 |
| Q |
313 |
ctgtgaggcagagtaggttgtgtagggttt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40248130 |
ctgtgaggcagagtaggttgtgtagggttt |
40248159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University