View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_low_44 (Length: 238)
Name: NF21128_low_44
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 65 - 222
Target Start/End: Complemental strand, 34967086 - 34966929
Alignment:
| Q |
65 |
ttgttctcaaacctctattatgctgatgtgtcatactttagagaagtttatcatcgaattgaattaccactccgattcttttcttgcctctttttaattc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34967086 |
ttgttctcaaacctctattatgctgatgtgtcatactttagagaagtttatcatctaattgaattaccactccgattcttttcttgcctctttttaattc |
34966987 |
T |
 |
| Q |
165 |
aaagttttgtttccttttgttaagatgtcatgttattgtgatggtttgcatttgccat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966986 |
aaagttttgtttccttttgttaagatgtcatgttattgtgatggtttgcatttgccat |
34966929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 34967916 - 34967853
Alignment:
| Q |
1 |
cactaaatttagacatacgctaaacatgaatttagacaaatttatatctttgtaatcgaacctt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34967916 |
cactaaatttagacatacgctaaacatgaatttagacaaatttatatctttgtaatcgaacctt |
34967853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University