View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_low_45 (Length: 238)
Name: NF21128_low_45
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 111 - 222
Target Start/End: Original strand, 9106451 - 9106562
Alignment:
| Q |
111 |
aaaataatcttctctatttttccctctttcttcttagtttgaggatattgcaaaaaattgcaggtccactaatatttttatcttttctaaacaaaacaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9106451 |
aaaataatcttctctatttttccctctttcttcttagtttgaggatattgcaaaaaattgcaggtccactaatatttttatcttttctaaacaaaacaaa |
9106550 |
T |
 |
| Q |
211 |
agtaacctcttt |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9106551 |
agtaacctcttt |
9106562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 33 - 115
Target Start/End: Original strand, 9106183 - 9106266
Alignment:
| Q |
33 |
aaaatgttttatctttt-atctagtgcaaaaacgctccccaatgagcattgatttgtaaacaaattagtgacatagatgaaaat |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9106183 |
aaaatgttttatctttttatctagtgcaaaaacgccccccaatgagcattgatttgtaaacaaattagtgacatagatgaaaat |
9106266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 135 - 222
Target Start/End: Original strand, 8754096 - 8754184
Alignment:
| Q |
135 |
tctttcttct-tagtttgaggatattgcaaaaaattgcaggtccactaatatttttatcttttctaaacaaaacaaaagtaacctcttt |
222 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||| | ||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
8754096 |
tctttcttctctagtttgaacatattgcaaaatattgcaggtccactattttttctatcttttctaatcaaaacaaaaggaacctcttt |
8754184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University