View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21128_low_49 (Length: 206)
Name: NF21128_low_49
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21128_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 23975769 - 23975601
Alignment:
| Q |
24 |
gtttggccaggggcgataacgatgacgtcggtcttgaatggatcggtgtagtcagcatctagtgcaacaactgtgaaattgtgatttgctattttgaaga |
123 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| |||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23975769 |
gtttggccaggggcgataacgatgatgtcagtctcgaatggattcgtgtagtcagcatccagtgcaacaactgtgaaactgtgatttgctattttgaaga |
23975670 |
T |
 |
| Q |
124 |
aaagatgattattgagtgcaacattgattattcgtagtaagtatgtcatccctggtttcaccttcatct |
192 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23975669 |
aaagattgttattgagtgcaacattgattatccgtagcaagtatgtcatccctggtttcaccttcatct |
23975601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 166
Target Start/End: Complemental strand, 6026172 - 6026096
Alignment:
| Q |
90 |
acaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagta |
166 |
Q |
| |
|
|||||||||||| | || |||||||| ||||||||| | || | |||||||||| ||||||| || ||||||||||| |
|
|
| T |
6026172 |
acaactgtgaaactatggtttgctatcttgaagaaatgttgttcattgagtgcagcattgataatgcgtagtaagta |
6026096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University