View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21128_low_49 (Length: 206)

Name: NF21128_low_49
Description: NF21128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21128_low_49
NF21128_low_49
[»] chr7 (1 HSPs)
chr7 (24-192)||(23975601-23975769)
[»] chr4 (1 HSPs)
chr4 (90-166)||(6026096-6026172)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 23975769 - 23975601
Alignment:
24 gtttggccaggggcgataacgatgacgtcggtcttgaatggatcggtgtagtcagcatctagtgcaacaactgtgaaattgtgatttgctattttgaaga 123  Q
    ||||||||||||||||||||||||| ||| |||| ||||||||  |||||||||||||| |||||||||||||||||| |||||||||||||||||||||    
23975769 gtttggccaggggcgataacgatgatgtcagtctcgaatggattcgtgtagtcagcatccagtgcaacaactgtgaaactgtgatttgctattttgaaga 23975670  T
124 aaagatgattattgagtgcaacattgattattcgtagtaagtatgtcatccctggtttcaccttcatct 192  Q
    ||||||  ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
23975669 aaagattgttattgagtgcaacattgattatccgtagcaagtatgtcatccctggtttcaccttcatct 23975601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 166
Target Start/End: Complemental strand, 6026172 - 6026096
Alignment:
90 acaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagta 166  Q
    |||||||||||| | || |||||||| ||||||||| | || | |||||||||| ||||||| || |||||||||||    
6026172 acaactgtgaaactatggtttgctatcttgaagaaatgttgttcattgagtgcagcattgataatgcgtagtaagta 6026096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University