View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21129_low_5 (Length: 294)
Name: NF21129_low_5
Description: NF21129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21129_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 283
Target Start/End: Original strand, 504221 - 504491
Alignment:
| Q |
16 |
cttgggtcggagggagcacgatttcaattttttatatgaataaaaagatacatatatttggtctaaattagatgaaggtgtgtgtatca---ttgaagtg |
112 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
504221 |
cttggatcggagggagcacaatttcaattttttatatgagcaaaaagatacatatatttggtctaaattagatgaaggtgtgtgtatcatcattgaagtg |
504320 |
T |
 |
| Q |
113 |
ttgtaactactatggcagggtcatgtacgccaacggcaatggcagcggggtccccggatcattccatcaacccacacaatcatcatcagattaacatcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504321 |
ttgtaactactatggcagggtcatgtacgccaacggcaatggcagcggggtccccggatcattccatcaacccacacaatcatcatcagattaacatcat |
504420 |
T |
 |
| Q |
213 |
cggcaccaccaccgccaccactggtgaaagcagattaactcgccgaaatagtttcatacgatcttcttcat |
283 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504421 |
cggcaccaccaccgccaccaccggtgaaagcagattaactcgccgaaatagtttcatacgatcttcttcat |
504491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University