View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2112_high_7 (Length: 238)
Name: NF2112_high_7
Description: NF2112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2112_high_7 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 47 - 238
Target Start/End: Complemental strand, 47619176 - 47618985
Alignment:
| Q |
47 |
tttagcccgtaattagttgttattaatttggtgaattgattaatgtggttgcaggggatgatccagcacttataaaaaccaaattaaggcactgggctca |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619176 |
tttagcccgtaattagttgttattaatttggtgaattgattaatgtggttgcaggggatgatccagcacttataaaaaccaaattaaggcactgggctca |
47619077 |
T |
|
| Q |
147 |
agctgttgcttgttcagtaatgcaatctcattcatgatgaagtcaagtgtgggatacatacatcataaatatgttctgcttttctttctttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619076 |
agctgttgcttgttcagtaatgcaatctcattcatgatgaagtcaagtgtgggatacatacatcataaatatgttctgcttttctttctttt |
47618985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 48
Target Start/End: Complemental strand, 47619235 - 47619205
Alignment:
| Q |
18 |
tcaaagtattcggttgtgtttattgtatatt |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47619235 |
tcaaagtattcggttgtgtttattgtatatt |
47619205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University