View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2112_low_2 (Length: 286)
Name: NF2112_low_2
Description: NF2112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2112_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 54733526 - 54733254
Alignment:
| Q |
1 |
cattaaacagaagaatacacataaaggtttaaccttagtttacaatccaattttcacacaaattacatacacagattagctaggaataaatatggtttgt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733526 |
cattaaacagaagaagacacataaaggtttaaccttagtttacaatccaattttcaaacaaattacatacacagattagctaggaataaatatggtttgt |
54733427 |
T |
 |
| Q |
101 |
acttcatttattcgtagcttctgttgtcttgcaatgaatgcctccacggtgcgacgaaattcgtcgctgctcattccatcttcgggatataaactccatt |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54733426 |
acttcatttattcgtagcttccgttgtcttgcaatgaatgcctccaccgtgcgacgaaattcgtcgctgctcattccatcttcaggatataaactccatt |
54733327 |
T |
 |
| Q |
201 |
ttttctctttatcaacttcaatgtttttcctcttactcttatcattatcactctcacacctttgcaacactct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733326 |
ttttctctttatcaacttcaatgtttttcctcttactcttatcattatcactctcacacctttgcaacactct |
54733254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University