View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2112_low_8 (Length: 245)
Name: NF2112_low_8
Description: NF2112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2112_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 54733753 - 54733993
Alignment:
| Q |
1 |
gtcaccatggaaaataattagttaggttgcctcaatggggagaagctaaacacactcttatttggaatttggaatggtgctacacaagccaaaatacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733753 |
gtcaccatggaaaataattagttaggttgcctcaatggggagaagctaaacacactcttatttggaatttggaatggtgctacacaagccaaaatacatt |
54733852 |
T |
 |
| Q |
101 |
attattttaacttcnnnnnnnggctctaggtctaaatttgatgttttagct---------------tttgcttttaattagctaggaattgtacaagatt |
185 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54733853 |
attatgttaactt--ttttttggctctaggtctaaatttgatgttttagcttttgctttttatatctttgcttttaattagctaggaattgtacaagatt |
54733950 |
T |
 |
| Q |
186 |
ctcaaggagaaaatagatattatgataactttccctctttgatg |
229 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54733951 |
ctcaa-gagaaaaaagatattatgataactttccctctttgatg |
54733993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University