View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21131_low_7 (Length: 287)
Name: NF21131_low_7
Description: NF21131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21131_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 46379563 - 46379801
Alignment:
| Q |
1 |
tgggaattcaaaatttagaataccattatggaatgctgttagaaactgtgttggagatcatttttctgcattattctctgtcgtaattaataaatattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379563 |
tgggaattcaaaatttagaataccattatggaatgctgttagaaactgtgttggagatcatttttctgcattattctctgtcgtaattaataaatattgc |
46379662 |
T |
 |
| Q |
101 |
atgcatctgcattggaattcaaattatagcaccaaatataaaaagctttagtttcgacttttaatgcagaaaaagtagtggtgtttgagttggaatttga |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379663 |
a----------ttggaattcaaattatagcaccaaatataaaaagctttagtttcgacttttaatgcagaaaaagtagtggtgtttgagttggaatttga |
46379752 |
T |
 |
| Q |
201 |
aaatgtcgatgtcaagcaagtcaagttgggttgggaggaagcctgtgaa |
249 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
46379753 |
aaatgtcgatgtcaagcgagttaagttgggttgggaggaagcctgtgaa |
46379801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University