View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21133_low_6 (Length: 241)
Name: NF21133_low_6
Description: NF21133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21133_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 13768893 - 13768694
Alignment:
| Q |
17 |
tgaaagcatgatacaacccagaag---tttgtggcttgatccatctttttcaaggatacattaacataatttgtacaggcagttgcgaccaagactataa |
113 |
Q |
| |
|
|||||||||||||||||||||||| || || |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13768893 |
tgaaagcatgatacaacccagaagaagttcgttgcttcatccatctttttcaaggacacattaacataatttgtacaggcagttgcgaccaagactataa |
13768794 |
T |
 |
| Q |
114 |
ctcaagaaagaagctctgacgaagaattaccaagatagtatttaacttctttgtcatttttagtataagtttgcgttatctagcattctttaaaatttct |
213 |
Q |
| |
|
|| ||||||||||||||||| ||||| | || ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13768793 |
cttaagaaagaagctctgaccaagaa-----agaatggtagataacttctttgtcatttttagtattagtttgcgttatctagcattctttaaaatttct |
13768699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University