View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21134_low_12 (Length: 396)
Name: NF21134_low_12
Description: NF21134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21134_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 31797844 - 31797622
Alignment:
| Q |
15 |
cacagagacaagtaatgccactagaataaataagatcagaaatttcaattatatgcacgaagatatgttttctcataagaactttggagttgaaacagat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31797844 |
cacagagacaagtaatgccactagaataaataagatcagaaatttcaattatatgcacgaagatatgttttctcataagaactttggagttgaaacagat |
31797745 |
T |
|
| Q |
115 |
tatacttgttgcacacaaactttgtataatgatgctagtagttggtgtacaacgagcagtgccatttttcatgaccataagtattcactatatcatccaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31797744 |
tatacttgttgcacacaaactttgtataatgatgctagtagttggtgtacaacgagcagtgccatttttcatgaccataagtattcactaaatcatccaa |
31797645 |
T |
|
| Q |
215 |
tatgtaaaattgagcttatgaaa |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31797644 |
tatgtaaaattgagcttatgaaa |
31797622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 46 - 116
Target Start/End: Complemental strand, 31787378 - 31787308
Alignment:
| Q |
46 |
aagatcagaaatttcaattatatgcacgaagatatgttttctcataagaactttggagttgaaacagatta |
116 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
31787378 |
aagatcggacatttcaattatatgcacgaagatatgatttctcacaagaactttggagttgaaagagatta |
31787308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 31787210 - 31787163
Alignment:
| Q |
188 |
accataagtattcactatatcatccaatatgtaaaattgagcttatga |
235 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| | ||||||| |
|
|
| T |
31787210 |
accataagtattcactatatcatcaaataggtaaaatttatcttatga |
31787163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University