View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21134_low_22 (Length: 281)
Name: NF21134_low_22
Description: NF21134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21134_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 262
Target Start/End: Complemental strand, 15176378 - 15176123
Alignment:
| Q |
7 |
ggagcagagaggagaatgtgtcctggctatggtttagcattgttgcacttggaatactttgttgccaattttgttttgaattttgagtggaaagttgtgg |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15176378 |
ggagcagggaggagaatgtgtcctggctatggtttagcattgttgcacttggaatactttgttgccaattttgttttgaattttgagtggaaagttgtgg |
15176279 |
T |
 |
| Q |
107 |
atggaaatgagattgatttgtcagaaatgcttcaattcacaactgtcatgaagaaccctttgaaggttcatctaatgcctaggttttagttatttttaga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15176278 |
atggaaatgagattgatttgtcagaaatgcttcaattcacaactgtcatgaagaaccctctaaaggttcatctaatatctaggttttagttatttttaga |
15176179 |
T |
 |
| Q |
207 |
accaattatccatagataaatcttgatttcatgttttgaattgtgttccagattgt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15176178 |
accaattatccatagataaatcttgatttcatgtttcgaattgtgttccagattgt |
15176123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 98
Target Start/End: Original strand, 26494968 - 26495008
Alignment:
| Q |
58 |
gaatactttgttgccaattttgttttgaattttgagtggaa |
98 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
26494968 |
gaatactttgttgctaatttggttttgaactttgagtggaa |
26495008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University