View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21134_low_25 (Length: 249)
Name: NF21134_low_25
Description: NF21134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21134_low_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 36675719 - 36675957
Alignment:
| Q |
11 |
aagaaataacaaacacaaaccttaacactgagagagtaaagaacaatttcaccagtagtagtaacatttaaatgcaagattgtgagacgcatgttttgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675719 |
aagaaataacaaacacaaaccttaacactgagagagtaaagaacaatttcaccaatagtagtaacatttaaatgcaagattgtgagacgcatgttttgca |
36675818 |
T |
 |
| Q |
111 |
aaccagatacaattttcaagagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaatgca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675819 |
aaccagatacaattttcaagagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaatgca |
36675918 |
T |
 |
| Q |
211 |
agattgaatctcaccaactttttcaccaatagtagctac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675919 |
agattgaatctcaccaactttttcaccaatagtagctac |
36675957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 29 - 207
Target Start/End: Complemental strand, 46922450 - 46922272
Alignment:
| Q |
29 |
accttaacactgagagagtaaagaacaatttcaccagtagtagtaacatttaaatgcaagattgtgagacgcatgttttgcaaaccagatacaattttca |
128 |
Q |
| |
|
|||||||| |||||||| || | |||| |||| ||| ||||| ||||| | |||||||||||||||| || ||||||| ||| || || |||| |
|
|
| T |
46922450 |
accttaacgctgagagaatagaagacaaattcatcagctgtagtgacattaaggtgcaagattgtgagacacaatccatgcaaactagaaaccatcttca |
46922351 |
T |
 |
| Q |
129 |
agagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaat |
207 |
Q |
| |
|
||||||| ||||| || || ||| ||||||||| |||||||||||| |||| |||||||| ||||| || |||||||| |
|
|
| T |
46922350 |
agagctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtaacttcaatatcagcaat |
46922272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University