View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_high_10 (Length: 314)
Name: NF21135_high_10
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 104 - 298
Target Start/End: Original strand, 3924007 - 3924201
Alignment:
| Q |
104 |
gattctggtggcaccctttttggaatatcaccaacagcgaactttacatgaccaatgaacatacctgacgtcctgtctttcaagaaaacatctacgttgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3924007 |
gattctggtggcaccctttttggaatatcaccaacagcgaactttacatgaccaatgaacatacctgacgtcctgtctttcaagaaaacatctacgttgc |
3924106 |
T |
 |
| Q |
204 |
tagagctattttttccattatcaaaagcaaacacttggttcaatgatgagttgctggtttctaagaaaaatgttgttgcttttacgtttccaagt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3924107 |
tagagctattttttccattatcaaaagcaaacacttggttcaatgatgagttgctggtttctaagaaaaatgttgttgcttttgcgtttccaagt |
3924201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 3923961 - 3923852
Alignment:
| Q |
1 |
gaaccttgctagaggggctatcatgttgtctatgtggtttggaacacaagcagatgaatattttcctcaagcatggtgttcagatacaacagagataact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923961 |
gaaccttgctagaggggctatcatgttgtctatgtggtttggaacacaagcagatgaatattttcctcaagcatggtgttcagatacaacagagataact |
3923862 |
T |
 |
| Q |
101 |
gatgattctg |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
3923861 |
gatgattctg |
3923852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University