View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_high_16 (Length: 277)
Name: NF21135_high_16
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 23 - 275
Target Start/End: Complemental strand, 31389607 - 31389355
Alignment:
| Q |
23 |
acacttgtccttaaaaaatgtatgatatttgtaattgatattgtatttttaaattctcttttatgtaagttgctatccttcttgtaatccttttaagtat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31389607 |
acacttgtccttaaaaaatgtatgatatttgtaattgatattgtatttttaaattctcttttatgtaagttgctatccttcttgtaatccttttaagtat |
31389508 |
T |
 |
| Q |
123 |
ttttgaattcagcattctgttcgacctttctcttctctgcttttttatctttgcttgtgaaacttttaagccgattgataagtactgtgagaggcaaatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31389507 |
ttttgaattcagcattctgttcgacctttctcttctctgcttttttatctttgcttgtgaaacttttaagccgattgataagtactgtgagaggcaaatg |
31389408 |
T |
 |
| Q |
223 |
attgatctggcatgtcatcagggacgtgatctgaaggtaaaagtaaagatact |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31389407 |
attgatctggcatgtcatcagggacgtgatctgaaggtaaaagtaaagatact |
31389355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 201 - 277
Target Start/End: Complemental strand, 31462104 - 31462028
Alignment:
| Q |
201 |
taagtactgtgagaggcaaatgattgatctggcatgtcatcagggacgtgatctgaaggtaaaagtaaagatactca |
277 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31462104 |
taagaactgtgagaggcaaatgattgatctggcatgtcatcagggacgtgatctgaaggtaaaagtaaagatactca |
31462028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University