View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_high_19 (Length: 259)
Name: NF21135_high_19
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 41980412 - 41980161
Alignment:
| Q |
1 |
ttggggattaagcttgttactgtttctggtgctcctttgatttgtggttttgagaattatgcattggtgcttaatgaaccttccactcaccctcttcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980412 |
ttggggattaagcttgttactgtttctggtgctcctttgatttgtggttttgagaattatgcattggtgcttaatgaaccttccactcaccctcttcaag |
41980313 |
T |
 |
| Q |
101 |
gtttttcctcttacaagtattttctttatttctcatattaaaaggtgtgtctggtgtatgacacgtttggatgtctgattgaaatgtacataacaccaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41980312 |
gtttttcctcttacaagtattttctttatttctcatatt-aaaggtgtgtctggtgtatgacacgtttggatgtctgattgacatgtacataacaccaac |
41980214 |
T |
 |
| Q |
201 |
gaatgtggttatattcaatcactttgagttttttaaattattacaactgttta |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41980213 |
gaatgtggttatattcaatcactttgagttttttaaattattataactgttta |
41980161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University