View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_high_20 (Length: 250)
Name: NF21135_high_20
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_high_20 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 40383989 - 40383748
Alignment:
| Q |
9 |
gagatgaaggtcaccgtggtgtttccggtggagaacgccgccgtgtctccatcggcacagacatcatccacgatccaatcattttgttcttggatgaacc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383989 |
gagatgaaggtcaccgtggtgtttccggtggagaacgccgccgtgtctccatcggcacagacatcatccacgatccaatcattttgttcttggatgaacc |
40383890 |
T |
 |
| Q |
109 |
aacctctggacttgactctacaagcgcttacatggtggtgaaggttttgcagagaattgctcagagcggtagcatcgtcatgatgaccgttcatcaacca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383889 |
aacctctggacttgactctacaagcgcttacatggtggtgaaggttttgcagagaattgctcagagcggtagcatcgtcatgatgaccgttcatcaacca |
40383790 |
T |
 |
| Q |
209 |
agctacagaatccttggtttgttagaccgtttgatcttcctt |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40383789 |
agctacagaatcctcggtttgttagaccgtttgatcttcctt |
40383748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University